Supplemental Data


Abstract
Full Text
A Combined Experimental and Computational Strategy to Define Protein Interaction Networks for Peptide Recognition Modules
Amy Hin Yan Tong, Becky Drees, Giuliano Nardelli, Gary D. Bader, Barbara Brannetti, Luisa Castagnoli, Marie Evangelista, Silvia Ferracuti, Bryce Nelson, Serena Paoluzi, Michele Quondam, Adriana Zucconi,Christopher W. V. Hogue, Stanley Fields, Charles Boone, Gianni Cesareni

Supplementary Material


Supplemental Figure 1.


Medium version | Full size version


S2. Phage Display Analysis

DNA fragments corresponding to each of the 28 yeast SH3 domains were PCR amplified from yeast genomic DNA and ligated into one of the pGEX expression vectors (Pharmacia) such that they were fused to the glutathione S-transferase gene, creating pGex-Abp1(535-591), which codes for an Abp1 SH3 domain spanning residues 535 to 591 within the Abp1 protein; pGex-Bbc1(8-67); pGex-Bem1-1(75-130); pGex-Bem1-2(158-215); pGex-Boi1(16- 73); pGex-Boi2(46-105); pGex-Bud14(262-318); pGex-Bzz1-1(496-553); pGex-Bzz1-2(580-633); pGex-Cdc25(61-126); pGex-Cyk3(12-68); pGex-Fus1(439-511); pGex-Hof1(602-665); pGex-Myo3(1119-1179); pGex-Myo5(1088-1145); pGex-Nbp2(113-169); pGex-Pex13(309-370); pGex-Rvs167(424-480); pGex-Sdc25(29-95); pGex-Sho1(303-359); pGex-Sla1-1(6-68); pGex-Sla1-2(71-131); pGex-Sla1-3(355-413); pGex-Yfr024c(317-373); pGex-Ygr136w(56-110); pGex-Yhl002w(220-274); pGex-Ypr154w(57-111); and pGex-Ysc84(411-468). After expression and affinity purification, the 25 SH3 domains that could be prepared in a soluble form (all but Bem1-2, Cdc25, Sla1-1, and Sla1-2) were used to screen a random nonapeptide library displayed at high density by fusion to the bacteriophage lambda fd pVIII gene [F. Felici, L. Castagnoli, A. Musacchio, R. Jappelli, G. Cesareni, J Mol Biol222, 301 (1991); G. Cestra et al., J Biol Chem274, 32001. (1999)]. Phage clones were selected by binding to the GST fusion protein through three cycles of binding and washing. Binding to the appropriate SH3 domain was confirmed by ELISA assay and the sequence of the displayed peptides deduced from the DNA sequence of the hybrid pVIII gene. We also tested, by ELISA assay, 40 different peptides, two representative clones from the list that were successful in the selection experiment, against each of the 25 soluble SH3 domains (see S3). Some SH3 domains (Abp1, Bbc1, Bem1-1, Bzz1-2, Sdc25, Hof, Myo3, Myo5, Nbp2, Rvs167, Sla1-3, Yfr024c, Ygr136w,Yhl002w, Ypr154w, Ysc84) were also screened with a library [A. B. Sparks, L. A. Quilliam, J. M. Thorn, C. J. Der, B. K. Kay, J Biol Chem269, 23853 (1994)] that invariantly had proline at specific residues 1064987xPxxP1064987x (x = any amino acid, P = proline). To map the SH3 domain target sites within Las17, five different fragments of the LAS17 gene, encoding proline rich peptides, were fused to the D gene of bacteriophage lambda, between the Spe I and Not I sites of the lambda display vector nameDsplay1 [A. Zucconi, L. Dente, E. Santonico, L. Castagnoli, G. Cesareni, J Mol Biol307, 1329 (2001)], then displayed at high density for panning experiments.

S4. Profile Matrix Used to Score the Yeast Peptides Containing Ligand Consensus Sequences.

The position-specific scoring matrix (PSSM) used to search for potential target peptides is based on 20 rows by 9 columns matrices. For a specific SH3 domain, each element of the profile matrix contains a position-specific score that is derived from the frequency of each of the 20 amino acid (rows) at each of the nine positions (columns) in the list of the aligned ligand peptides. When scanning the yeast proteome the PSSM calculates a total score representing the likelihood that the query peptide binds to the SH3 domain under consideration. This is obtained by summing, over the nine peptide positions, the elements of the PSSM corresponding to the specific amino acid found at that position in the query peptide. We tried several scoring matrices whose elements were calculated in different ways. In the simplest approach the matrix contains the frequency of occurrence of a specific amino acid at any given position of the peptide ligand. However, the number of ligands selected for each SH3 domain (10-20) is not sufficient to provide statistically significant frequencies in the positions that are not conserved. We improved the method by incorporating, in the PSSM, complementary information extracted from the peptides that do not bind a specific SH3 domain. This list of "non-binder" peptides was obtained from ELISA assays in which 40 different peptides (see S3), two representative clones from the list that were successful in the selection experiment, were tested against each of the 25 soluble SH3 domains. As expected, a PSSM obtained simply by subtracting the "negative" from the "positive" frequencies did not perform well because the list of non-binders was obtained by screening a biased peptide collection (most of the peptides tested contain PxxP). Instead, positive and negative frequencies were combined, according to an empirical function designed to lessen the contribution of the non-binder peptides in the positions that were conserved in the binding ligands. We examined several functions whose prediction results only differed slightly, thereby moving the score of some potential target proteins above or below the empirically set threshold of 20% of the maximum score. The interaction network displayed in Fig. 2A was obtained with the function Sij= pij-nij(1-pij)2 where Sij is the score at the position ij of the matrix and pij and nij are the frequencies of occurrence of amino acid i at position j in the peptides that do and do not bind the SH3 domain respectively. This method scores proline-rich peptides relatively high, even if they do not contain some of the ligand consensus residues. To overcome this problem, we included a step in which all the peptides that do not contain a close match to the consensus sequence were filtered out. Because the paralogs Myo3 and Myo5 selected peptides with the same consensus residues, the peptide data were pooled and the SH3 domains were analyzed together.

S7. Visualization of Protein-Protein Interaction Networks

Data from networks predicted for phage display and the two-hybrid interactions were assembled as lists of yeast gene name pairs. The yeast import tool for the BIND project (http://www.bind.ca) was used to convert the gene name pairs into BIND protein-protein interaction records [G. D. Bader et al., Nucleic Acids Res.29, 242 (2001)]. This tool integrates yeast gene name information from the Saccharomyces Genome Database (SGD), the Munich Information Center for Protein Sequences (MIPS), RefSeq [S. A. Chervitz et al., Nucleic Acids Res., 27, 74 (1999); M. C. Costanzo et al. Nucleic Acids Res., 29, 75 (2001); H. W. Mewes et al., Nucleic Acids Res., 28, 37-40 (2000); K. D. Pruitt, D. R. Maglott Nucleic Acids Res., 29, 137 (2001)], and the SGD gene registry, to unambiguously assign any yeast gene name, present in these resources, to a GenBank sequence record from the NCBI RefSeq project. Yeast protein-protein interaction data sets were imported from YPD, MIPS and previous large-scale genome-wide screens for comparison [P. Uetz et al., Nature, 403, 601 (2000); T. Ito et al., Proc Natl Acad Sci U S A97, 1143 (2000); T. Ito et al., Proc Natl Acad Sci U S A98, 4569 (2001). B.L. Drees et al., J Cell Biol154, 549 (2001)]. For network visualization and analysis, BIND can export a molecular interaction network as a Pajek network file, which can be viewed with the Pajek program for large network analysis [http://vlado.fmf.uni-lj.si/pub/networks/pajek/; D. White, V. Batagelj, A. Mrvar, Computer Review17, 245-274 (1999)]. The format of the Pajek network file can be found in the Pajek web site. Figures 2 and 3 were created with the Pajek program using a Kamada-Kawai automatic layout with subsequent manual alterations to remove node overlap. Node coloring was done in Pajek by partitioning the network by k-core and colouring by partition. The network comparisons were done by first converting all available protein-protein interaction data sets into BIND records, using standard RefSeq accession numbers and then comparing one set of binary interactions to another in a reflexive manner (A-B = B-A, where A and B are proteins) using set operations e.g. set intersection to find common interacting pairs between sets. Computer programs were written to automatically perform the random network modeling. A core finding algorithm is present in the Pajek package and can be applied to single networks. For convenience, a core finding function was written for use in the random network model programs. This algorithm takes as input a connected graph and proceeds by first removing nodes from the graph of degree less than k and then iteratively removing other nodes in the graph that are not connected by at least k edges to other remaining nodes. A core finding algorithm finds a subset of highly connected nodes that are central to the network. The core analysis seems to work well with this particular data set because it is relatively small and focused on functionally related proteins. We find that other measures of connectivity, targeting specific regions of a network, are more informative for larger data sets. All tools from the BIND project used here are written in ANSI C using the cross-platform NCBI Toolkit (http://www.ncbi.nlm.nih.gov/IEB/). Programs were developed and run on the Linux and the Windows computer platform. BIND source code is freely available under the GNU Public License at http://sourceforge.net/projects/slritools.


Supplemental Figure 8.


Medium version | Full size version


S9. Two-Hybrid Materials and Methods

For two-hybrid screens with ordered ORF-Gal4 activation domain (AD) fusion arrays, fragments coding for the SH3 domain(s) of a particular protein were PCR amplified from yeast genomic DNA and cloned into the pOBD plasmid [P. Uetz et al., Nature, 403, 601 (2000)], generating the following Gal4 DNA binding-domain (DBD) bait plasmids: p3388, encoding Abp1(351-592); p3771, Bbc1(1-90); p3519, Bem1(51-240); p3520, Bem1(1-551); p3522, Boi1(1-100); p3523, Boi2(21-130); p3705, Bud14(241-340); p3390, Bzz1(476-564); p3391, Bzz1(562-633); p3392, Bzz1(476-633); p3694, Cdc25(36-150); p3774, Fus1(401-512); p3842, Hof1(576-669); p3497, Myo3(1054-1271); p3696, Pex13 (286-386); p3697, Rvs167(401-482); p3743, Sdc25(1-103); p3383, Sho1(281-368); p3700, Sla1(1-150); p3735, Sla1(1-435); p3737, Sla1(61-150); p3699, Sla1(336-435); p3384, Yfr024c(291-373); p3770, Yhl002w(217-276); p3704, Ypr154w (38-130); p3755, Ysc84(391-468). The ordered array is a set of yeast colonies derived from about 6,000 individual transformants in which each of the yeast ORFs was inserted into a Gal4 transcriptional activation domain vector to create a hybrid protein. The array expresses approximately 85-90% of the predicted open reading frames of S. cerevisiae in strain PJ69-4a (MATa) [P. James, J. Halladay, E. A. Craig, Genetics144,1425 (1996)]. Twenty six Gal4 DBD fusions were transformed into PJ69-4name (MATname) [ P. James, J. Halladay, E. A. Craig, et al., ibid., p1425]. To screen for protein-protein interactions, each of these transformants was mated to all of the transformants of the array. Diploids were selected using markers carried on the two-hybrid plasmids. The diploids were then transferred to selective plates lacking histidine, and colonies positive for the two-hybrid reporter HIS3 gene were identified by their positions in the array.

For two-hybrid library screens [C. T. Chien, P. L. Bartel, R. Sternglanz, S. Fields, Proc Natl Acad Sci U S A88, 9578-82. (1991)], the DBD baits were derivatives of pEG202 (LexA DBD) [J. Gyuris, E. Golemis, H. Chertov, R. Brent, Cell75, 791 (1993)], pOBD(Gal4 DBD) [P. Uetz et al., Nature, 403, 601 (2000)], or p21.29 (AmpR, ColE1ORI, TRP1, CEN6, Gal4 DBD), and the AD-fusion libraries were a yeast genomic library in pJG4-5 [J. Gyuris, E. Golemis, H. Chertov, R. Brent, Cell75, 791 (1993)], a yeast cDNA in pACT [T. Durfee et al., Genes Dev. 7, 555 (1993)], a yeast genomic library in pACT [provided by B. Distal], or a yeast genomic library in pACT2 [M. Fromont-Racine, J.-C. Rain, P. Legrain, Nature Genetics16, 277 (1997)]. The two-hybrid host strains were Y704 (MATalexAop-LEU2 lexAop-lacZ) [Evangelista et al., Science276, 118 (1997)]; Y1003 (MATa/namelexAop-ADE2 lexAop-lacZ), a diploid version of Y704; Hf7c (MATa GAL1-HIS3 GAL1-LacZ) (Clonetch); Y1251 (MATa/nameGAL-HIS3 GAL-lacZ) a diploid version of Y153 (T. Durfee et al., ibid., p. 555); or Y1252 (MATa/nameGAL1-HIS3GAL7-lacZ), a diploid version of PJ69-4a [P. Uetz et al., Nature, 403, 601 (2000)]. The pEG202 bait plasmids expressing SH3 domains or SH3 domain proteins were p3632, Bbc1(1-90); p2644 Bzz1(1-633); p2100, Fus1(401-512); p1002 Fus1(97-512); p1190, Myo3(1054-1271); p1474, Myo5(1020-1219); p3530, Sho1(281-368); and p3731, Ypr154w (38-130). The pOBD bait plasmid p3770, expressed the Yhl002w(217-276) SH3 domain. The p21.29 bait plasmids p21.29(Abp1-SH3) and p21.29(Rvs167-SH3), expressed the Abp1(535-592) and Rvs167(424-480) SH3 domains, respectively. The pEG202 bait plasmids expressing proline-rich target proteins or peptides were p3692, Bbc1(671-820); p890, Bni1(1227-1397); p3186, Las17(1-633); and p3268, Vrp1(1-817). The host strain was first transformed with a bait plasmid, then transformed with the activation domain library, selected for two-hybrid reporter-based growth, and finally screened for lacZ expression. AD library plasmids were extracted from the yeast cells, amplified in E. coli, transformed back into yeast to confirm the two-hybrid interaction, and finally sequenced to identify of the positive clone. From a screen with Hf7c carrying p21.29(Abp1-SH3), 4 pACT(genomic) positives (i.e., sequences that showed interaction with the DBD bait) were isolated from ~500,000 transformants. From a screen with Y1003 carrying p3632, Bbc1(1-90), 20 pACT2-positives were isolated from ~1.7x106 transformants. For Y1003 carrying p2644, Bzz1(1-633), 11 pACT2-positives were isolated from ~350,000 transformants. For Y704 carrying p2100, Fus1(401-512), 5 pJG4-5-positives were isolated from ~300,000 transformants, 1 pACT-positive from ~150,000 transformants, and 6 pACT2-positives from ~450,000 transformants. For Y704 carrying p1002, Fus1(97-512), 8 pJG4-5 positives were isolated from ~500,000 transformants. For screens with Y1003 carrying p1190, Myo3(1054-1271), 21 pACT(cDNA)-positives were isolated from ~260,000 transformants and 13 pACT2-positives from ~960,000 transformants; all of the positives obtained with the Myo3 bait were confirmed to interact with p1474, Myo5(1020-1219). From a screen with Hf7c carrying p21.29(Rvs167-SH3), 1 pACT(genomic)-positive was isolated from ~100,000 transformants. For Y704 carrying p3530, Sho1(281-368), 12 pACT2-positives were isolated from ~150,000 transformants. For Y1003 carrying p3731, Ypr154w (38-130), 24 pACT2-positives were isolated from ~520,000 transformants. For Y1251 carrying p3770, Yhl002w(217-276), 3 pACT2-positives were isolated from ~140,000 transformants and for Y1252 carrying p3770, 12 pACT2-positives were isolated from ~630,000 transformants. For Y1003 carrying p3692, Bbc1(671-820), 15 pACT2-positives were isolated from ~1.2x106 transformants and 2 pACT(cDNA)-positives were isolated from ~810,000 transformants. For Y704 carrying p890, Bni1(1227-1397), 3 pJG4-5 positives were isolated from ~580,000 transformants. For Y1003 carrying p3186, Las17(1-633), 26 pACT2 positives were isolated from ~750,000 transformants. For Y1003 carrying p3268, Vrp1(1-817), 24 pACT2-positives were isolated from ~2.6x106 transformants. The final list of positive interactions derived from the conventional two-hybrid screens was edited for genes that were identified multiple times and for some frequent false positives.

Directed two-hybrid assays were performed with derivatives of pEG202, expressing DBD fusion proteins, and pJG4-5, expressing AD fusion proteins (J. Gyuris, E. Golemis, H. Chertov, R. Brent, ibid., p791). Y1026 (MATalexAop-lacZ ura3-1 leu2-3,-112 his3-11,-15 trp1-1 ade2-1 can1-100) was first transformed with a pEG202 DBD plasmid, then mated to a panel of Y860 (MATname lexAop-ADE2 ura3-1 leu2-3,-112 his3-11,-15 trp1-1 ade2-1 can1-100) strains transformed with a pJG4-5 AD plasmid expressing SH3 domain fusions, and resulting diploid cells were assayed for lexAop-lacZ expression [D. C. Hagen, G. McCaffrey, G. F. Sprague Jr., Mol. Cell. Biol.11, 2952 (1991)]. p2880, is a pEG202 plasmid encoding Pbs2(92-101). The pEG202-derived plasmids encoding proline-rich target protein sequences were p3692, Bbc1(617-820); p890 Bni1(1227-1397); p1801, Bnr1(756-950); p3186, Las17(1-633); p3268, Vrp1(1-817); p4293, Ynl094w(1-587); and p4294, Ynl094w(456-587). The pJG4-5-derived plasmids encoding SH3 domains were p3784, encoding Abp1(511-592); p3648, Bbc1(1-90); p3502, Bem1(51-153); p3645, Bem1(134-240); p3556, Boi1(1-100); p3646, Boi2(21-130); p3730, Bud14(241-340); p2863, Bzz1(476-564); p2770, Bzz1(562-633); p2771, Bzz1(476-633); p3706, Cdc25(36-150); p3739, Cyk3(1-90); p2101, Fus1(401-512); p3756, Hof1(576-669); p1202, Myo3(1054-1271); p1475, Myo5(1020-1219); p3709, Nbp2(91-190); p3710, Pex13(286-386); p3711, Rvs167(401-482); p3745, Sdc25(1-103); p2637, Sho1(176-368); p3492, Sho1(281-368)P352A; p3734, Sla1(336-435); p3785, Yfr024c(291-373); p3742, Ygr136w(31-130); p2765, Yhl002w (217-276); p3732, Ypr154w (38-130); and p3746, Ysc84(391-468). We also tested mutant forms of the Myo3 and Bzz1 SH3 domains, each of which contained a single amino acid substitution of a conserved residue, for two-hybrid interactions with the proline-rich target protein sequences (31). pJG4-5-derived plasmids that express AD fusions to mutant SH3 domains (31) were p1740, Myo3p W1157S (1054-1271), which contains a single amino acid substitution of tryptophan 1157 to serine (19); p3582, Bzz1W531S (476-633), which contains a single amino acid substitution of tryptophan 531 to serine within the Bzz1-1 SH3 domain; p3584, Bzz1W615S (476-633), which contains a single amino acid substitution of tryptophan 615 to serine within the Bzz1-2 SH3 domain; p3586, encoding Bzz1W531S,W615S (476-633), which contains amino acid substitutions within both SH3 domains.


Supplemental Figure 11.


Medium version | Full size version


Supplemental Figure 12.


Medium version | Full size version


S13. Observations that support overlap of the protein-protein interaction networks derived from phage display and two-hybrid analysis

1) Rvs167 coimmunoprecipitates with Myc epitope-tagged Acf2, Ymr192w, and Ypl249c (H. Friesen, K. Colwill, and B. Andrews, personal communication).

2) Rvs167 coimmunoprecipitates with HA-tagged Las17 (M. Evangelista, C. Boone unpublished data).

3) Myc-tagged Myo3 coimmunoprecipitated with HA-tagged Bni1, albeit under conditions where Bni1 was overexpressed, indicating that the full-length proteins can interact in vivo (M. Evangelista, C. Boone unpublished data).

4) Myo3 and Myo5 interact with Las17 and Vrp1 in vivo [M. Evangelista et al., J Cell Biol148, 353-62. (2000)]..

5) Myo5 coimmunoprecipitated with Myc-tagged Bbc1 (M. Evangelista, C. Boone unpublished data).

6) Deletion of the ABP1 gene leads to mislocalization of Ark1 and Prk1 [M. J. Cope, S. Yang, C. Shang, D. G. Drubin, J. Cell Biol.144,1203 (1999)], Localization of Ark1 and Prk1 to actin cortical patches depends on the interaction between the SH3 domain of Abp1 and the COOH-terminal proline rich region of Ark1 and Prk1 (Brannetti et al, submitted for publication).

7) The Abp1 SH3 domain binds to Srv2 [N. L. Freeman et al., Mol. Cell. Biol.16, 548 (1996); T. Lila, D. G. Drubin, Mol. Biol. Cell8, 367 (1997)]

8) PSI BLAST analysis showed that Ydl146w shares homology with the N-WASP binding protein WISH [M. Fukuoka et al., J. Cell Biol. 152, 471 (2001)], which supports the possibility if a Ydl146w-Bzz1-Las17 complex.

9) Like Las17, Vrp1, Abp1, Myo3, Myo5, Sla1, Rvs167 and Ypr171w (9), we found that Bzz1-GFP, Bbc1-GFP, Ysc84-GFP, and Ynl094w-GFP localized to cortical actin-like patches; we also found that BZZ1-VRP1 show a genetic interaction (see S16, Fig. 5).

10) The Sho1 SH3 domain interacts with Pbs2 in vivo [T. Maeda, M. Takekawa, H. Saito, Science269, 554 (1995)].

11) Genetic evidence indicates that pheromone-induced expression of Fus1 inhibits Sho1 from signaling through the Hog1 MAPK pathway, which may lower the osmotic potential of the cell and allow efficient cell fusion during mating (B. Nelson, C. Boone unpublished observations).

S14. Materials and Methods for Las17 Coimmunoprecipitation Experiments.

Gene fusions leading to a COOH-terminal tag containing 3 copies of the HA epitope (3HA) or 13 copies of the Myc epitope were constructed by PCR-based integration [M. S. Longtine et al., Yeast10, 953, (1998)] in W3031A (MATaura3-1 leu2-3, 112 his3-11, 15 trp1-1 ade2-1 can1-100). For the coimmunoprecipitation experiments involving Las17, we generated a set W3031A-derived strains expressing Las17-HA, Y1807 (LAS17::3HA-TRP1); Bzz1-Myc, Y3058 (BZZ1::13Myc-kanMX6); Bzz1-Myc and Las17-HA, Y3059 (BZZ1::13Myc-kanMX6 LAS17::3HA-TRP1); Ypr154w-Myc, Y3097 (YPR154w::13Myc-kanMX6); Ypr154w-Myc and Las17-HA, Y3098 (YPR154w::13Myc-kanMX6 LAS17::3HA-TRP1); Ygr136w-Myc, Y3099 (YGR136w::13Myc-kanMX6); Ygr136w-Myc and Las17-HA, Y3100 (YGR136w::13Myc-kanMX6 LAS17::3HA-TRP1); Yfr024c-Myc, Y3095 (YFR024c::13Myc-kanMX6); Yfr024c-Myc and Las17-HA, Y3096 (YFR024c::13Myc-kanMX6 LAS17::3HA-TRP1); Ysc84-Myc, Y3093 (YSC84::13Myc-kanMX6); Ysc84-Myc and Las17-HA, Y3094 (YSC84::13Myc-kanMX6 LAS17::3HA-TRP1); Bbc1-Myc, Y3060 (BBC1::13Myc-kanMX6); Bbc1-Myc and Las17-HA, Y3061 (BBC1::13Myc-kanMX6 LAS17::3HA-TRP1). To prepare the protein extracts, yeast cells were grown to early log phase and extracts were prepared by liquid nitrogen grinding in lysis buffer (0.1% Triton X-100, 50 mM Tris-HCl, 100 mM NaCl, 10 mM EDTA) with a protease inhibitor cocktail (10 mM Pefabloc, 50 ug/ml Leupeptin, 50ug/ml Pepstatin A, 50 ug/ml E64, 50 ug/ml Antipain, 50 ug/ml Chymostatin 20 mM Benzamidine, and 50 ug/ml Aprotinin from Boehringer Mannheim). Immunoprecipitations were carried out with 1.5 ml extracts, containing 20 to 25 mg/ml total protein, monoclonal antibody HA.11 (Berkeley Antibody Company), and G-Sepharose beads (Pharmacia). For immunoblot analysis, 25ug of total protein was loaded for detection of proteins in the yeast extract, 10% of the total immunoprecipitated material was loaded for detection of the immunoprecipitated protein and 90% was loaded for detection of the coimmunoprecipitated protein. The resultant proteins were subjected to immunoblot analysis, using rabbit polyclonal HA antibody (Berkeley Antibody Company), rabbit polyclonal c-Myc antibody (Santa Cruz), and rabbit polyclonal antibodies directed against Myo3p, or Rvs167p.

S15. Materials and Methods: Construction of pJG4-5 two-hybrid plasmids expressing AD fusions to Bzz1 SH3 domain mutants; construction of plasmids expressing BZZ1-GFP, BBC1-GFP, YNL094w-GFP, YSC84-GFP; localization of GFP fusion proteins.

p3582, a pJG4-5 plasmid that expresses an AD fusion to a 471-bp DNA fragment encoding Bzz1W531S (476-633), was created in six steps. First, we PCR a Bam HI to Not I DNA fragment encoding Bzz1p. Second, the product was ligated into pCRII-TOPO (InVitrogen) to create p2951, which provided a template for site-specific mutagenesis. Third, we amplified a 185-bp fragment (476-537) using primers (5'- GGGATCCAATCTATACGCACCACTAGTACCA-3' and 5'-GTCGTTATTTATCTTAGTACTTCCAGAACCCGT-3') that changed a tryptophan codon to a serine codon and incorporated Bam HI and Sca I sites (underlined). Fourth, we amplified a 111-bp fragment (527-564) using primers (5'-ACGGGTTCTGGAAGTACTAAGATAAATAACGAC-3' and 5'- GCGGCCGCTCAGCCTCTATCATTTGCTTTAACTC-3') that changed a tryptophan codon to a serine codon and incorporated Sca I and Not I sites (underlined). Fifth, we amplified a 471-bp fragment (476-633) using the products from the two reactions above and primers (5'-GGGATCCAATCTATACGCACCACTAGTACCA-3' and 5'- GCGGCCGCTCAGCCTCTATCATTTGCTTTAACTC-3'). Finally, the product was ligated into pJG4-5 to create p3582.

p3584, a pJG4-5 plasmid that expresses an AD fusion to a 471-bp DNA fragment encoding Bzz1W615S (476-633), was created in six steps. First, we PCR amplified a Bam HI to Not I DNA fragment encoding full-length Bzz1. Second, the product was ligated into pCRII-TOPO (InVitrogen) to create p2951, which provided a template for site specific mutagenesis. Third, we amplified a 171-bp fragment (476-619) using primers (5'- GGGATCCAATCTATACGCACCACTAGTACCA-3' and 5'- TTCACCATATGTCGACCCGCTACCGTCATC-3') that changed a tryptophan codon to a serine codon and incorporated Bam HI and Sal I sites (underlined). Fourth, we amplified a 69-bp fragment (610-633) using primers (5'- GATGACGGTAGCGGGTCGACATATGGTGAA-3' and 5'- GCGGCCGCTCATTTACAGTAACTTGTAGGAAA-3') that changed a tryptophan codon to a serine codon and incorporated Sal I and Not I sites (underlined). Fifth, we amplified a 471-bp fragment (476-633) using the products from the two reactions above and primers (5'-GGGATCCAATCTATACGCACCACTAGTACCA-3' and 5'- GCGGCCGCTCAGCCTCTATCATTTGCTTTAACTC-3'). Finally, the product was ligated into pJG4-5 to create p3584.

p3586 a pJG4-5 plasmid that expresses an AD fusion to a 471-bp DNA fragment encoding Bzz1W531S, W615S (476-633), was created in four steps. First, we amplified a 185-bp fragment (476-537) using p3584 as template and primers (5'- GGGATCCAATCTATACGCACCACTAGTACCA-3' and 5'-GTCGTTATTTATCTTAGTACTTCCAGAACCCGT-3') that changed a tryptophan codon to a serine codon and incorporated Bam HI and Sca I sites (underlined). Second, we amplified a 111-bp fragment (527-564) using primers (5'-ACGGGTTCTGGAAGTACTAAGATAAATAACGAC-3' and 5'- GCGGCCGCTCAGCCTCTATCATTTGCTTTAACTC-3') that changed a tryptophan codon to a serine codon and incorporated Sca I and Not I sites (underlined). Third, we amplified a 471-bp fragment (476-633) using the products from the two reactions above and primers (5'-GGGATCCAATCTATACGCACCACTAGTACCA-3' and 5'- GCGGCCGCTCAGCCTCTATCATTTGCTTTAACTC-3') that incorporated Bam HI and Not I sites (underlined). Finally, the product was ligated into pJG4-5 to create p3586.

Construction of plasmids expressing BZZ1-GFP, BBC1-GFP, YNL094w-GFP, YSC84-GFP.

A two-step process was used to create p2737, carrying BZZ1-GFP. First, we PCR amplified a 1.9-Kb fragment of BZZ1 with its corresponding promoter, with primers (5'-GCTCGAGAAGGGGCAGATTCTAACTTCTTG-3') and (5'-ACGCGTTTTACAGTCACTTGTAGGAAATAG-3') that incorporated an Xho I and Mlu I sites (underlined). Second the Xho I to Mlu I fragment encoding Bzz1 was ligated in frame with GFP in p1847, a pRS316-based plasmid [R. S. Sikorski and P. Hieter, Genetics122, 19 (1989)] containing GFP sequences from pRSETB (Pharmacia)

A two-step process was used to create p4355, carrying ADH1pr-BBC1-GFP. First, we PCR amplified a 3.5-Kb fragment of BBC1 with primers (5'- GGATCCATGAGTGAACCCGAAGTGCCCT-3') and (5'-ACGCGT CCAACCTACGTATCCTCTCGCA-3') that incorporated a Bam HI and Mlu I sites (underlined). Second the Bam HI to Mlu I fragment encoding Bbc1 was ligated behind the ADH1 promoter (ADH1pr), in frame with GFP, within p2226, a pRS316-based expression plasmid containing ADH1pr separated from GFP sequences pRSETB (Pharmacia) by a polylinker containing Bam HI and Mlu I sites.

A two-step process was used to create p4447, carryingADH1pr-YNL094W-GFP Ynl094w-GFP. First, we PCR amplified a 1.8-Kb fragment of YNL094w with primers (5'-TCTGCACAATATTTCAAGCTATACCAAGCATACAATCAACTCCAAGCTTCAGGGGAGATCTTTATGAATAGTCAAGGTTACGATGAAA-3') and (5'-GAATTGGGACAACTCCAGTGAAAAGTTCTTCTCCTTTACTCATGAATTCTCGATA ACGCGT GTTTGAATACTTCTCCCTAATTC-3') that incorporated a Bgl II and Mlu I sites (underlined). Second the Bgl II to Mlu I fragment encoding Ynl094w was ligated behind ADH1pr, in frame with GFP, within p4419, a plasmid similar to p2226 in with the Bam HI site converted into a Bgl II site. A two-step process was used to create p4356, carrying ADH1pr-YSC84-GFP. First, we PCR amplified a 1.5-Kb fragment of YSC84 with primers (5'- GGATCCATGGGTATCAATAATCCAATTCCT-3') and (5'-ACGCGT AGAAACTCTAACGTAGTTTGCAG-3') that incorporated a Bam HI and Mlu I sites (underlined). Second the Bam HI to Mlu I fragment encoding Ysc84 was ligated behind ADH1pr, in frame with GFP sequences, within p2226.

For localization of GFP derivatives, in W3031A (MATaura3-1 leu2-3, 112 his3-11, 15 trp1-1 ade2-1 can1-100) was transformed with p4355, p4356, p4447, and p2737, and observed by fluorescence microscopy with the fluorescein isothiocyanate filter set.


Supplemental Figure 16.


Medium version | Full size version


Supplemental Figure 17.


Medium version | Full size version


Supplemental Table 1. Phage display peptides selected by SH3 domains. The peptides shown in red were tested by ELISA assay for binding against all of the soluble SH3 domains. The amino acids in italics were not in a randomised position.
ProteinPVIII REPERTOIREPIII REPERTOIRE
Abp1RPKVPLPVK YYSPAVPERPGWLPG
RPLPPIPRR 3 LQSTTAPEVPERPWWI
KPLPRIPQK 2 SNAPPTPPRPPWLTSM
RPLLRDPAK 5
RALLRDPAK
Bem1_1PPHVSPYSP 5 No peptide selected
PPLVQPYAA
GPPVVPYRL 2
PPRVRPYVW
PPRISPYTS
PPPVAPYRK
Myo3PPPYPPPRL PPMYPPPNSPRQLHEE
RYPPSYSPPHPNLTAPGHPPPGVPN
LPSYDPPAVPSNASHV
TSVPSPPYLPPTIPKE
PPSYDPPARPRGTPDP
IGAMLGPAPPVPLDGG
Myo5 FPVNYISAQ MPTWPPPVAPAFDGVP
RHPPTYRPP PPFYEPPEVPRHVVSP
PPPYPPPPL YACWPPPPHPDPPCSP
WRPPQYRAP GEFLQPPSWPAPKPFE
PFFVVPPGKPPSPPEV
VPLYSPPKVPDYGSGA
XXPQWPPPXPPGXGAX
GYQYQVPSWPPPGIAG
VPGYPPPXXPHXXPLX
FTEEGHPSYPPPRPPX
Nbp2QPNRLAPRR DEGVFLPRRPAPSRPE 10X
RPRRAAPTP YWEPARPAPPIPGQRV 2X
LPLRAAPTV
KPSRPAPVP
VPRRSAVL
TPMRSAPRW
EPKRGAPRP
RDAPKPPVP
RSPPKPPAL
RAPPPRPIA
IIRPAPSRP
Pex13 FRALPKVPW QSSNLTPSVPRFWDAP
RRLPSVPPT WEPPQSPTLPAWWDLP
RSLPPLPTA FQGPPTPGAPAWWSNV
WKRPLPSAP GRAWDLPGIPSYSDNL
PRRRPPTVP DTSGGAPAVPPFWNQW
RPTPRVPVP YWHPQSPNPPKFWLGT
RPLPTLPPP FSTDSRPEAPMWWLGT
HVTVEQPXAPRWWKPA
FRAWSIPELPGPREPVSRP
PMLGQSPNPPRWWEHP
SYAAPVPGEPHIPPFF
VDSTPGPPIPAFWKET
ISGQFAPVKPSWWEPL
HVASSLPKRPGXXXDV
LRLHKAPVPPSWWEPL
Rvs167 RAVPPPPEQ SGDAGPPLPPRPKDWN
RPLPRPPGT DKPPPVPPRPGATRVD
RAVPQPPPKLASPWPPPLPPRPDLQ
RMRPVPSGP EGRPGPPNLPRPHSY
KLRPPLPPRPDVADEK
RPAVPPRTQ
SYPQLPNRR
LAPPLPPRS
RPPIPPRGR
RRPFPPPRS
Sla1-1No peptide selected
Sla1-2No peptide selectedNo peptide selected
Sla1-3AHRTPPSPPNo peptide selected
LHRPAPAPP
VHRQAPPPP
THRTPPAPP
KHRPAPAPP
TLRQPPSPP
FRLPPSIPSE
Ygr136w LTRPKYRNP VSFTEAPAIPPRYIEA
TRTRFALPSYLSHMAPPLPARIPEF
RRGRLQLPP CSMLAPPKVPPRFVAD
TRXPLPPP VLPEYKPTXPPRAGMS
YRARLLLPL NVGGPSPDIPVRPFVL
RPRYPIPGVPAVPLRPVLD
NHAPDLPPRPGVEYKT
PRLPPRHLL VRSPXVPDRPVAGNPP
SYPALPVRP LGLPPVPTRPTTLVTT
FSYKQRPPWPLPSTDA
YGREAHPLPPASNGSS
FVDRPPAPLP
Ypr154wFARPRVPPRL PAAYERPMQPLPSEGP
FLRPPVPKRP YIRPAFPLPPWNGDLS
SRLYDRPHWPTPVSDG
YSRPRLLPP GRDYTRPGLPLPLQED
YSRPKFPNP NNPYSRPKMPIPDQAL
FSRGRMPLPP
FFRPPYPLPQ FTHLSAPPVPARPNLD
FRRPAYALPP NLPPPIPLRPDGVSAP
FRRPPPIPLS
YKRPPISPP
YRRPPLPLP
YKRKPFPTP
Yhl002wPYRALPLPP
GYRPMPAVP
PYRSLPNPP
PPIPFKHPV
FRPSGGKYIA
FRPASLTYTP
FRPSTSHYTQ
FRPSNEHYTQ
FRPSSANYRS
FRPSAGHYRQ
Yfr024cNRPSLPPRG YVQAPGPELPARPLPG
IPPLPIRRL
PGPPVPRRP DSPPQLPFRPGSVSAP
PPPLPNRRR AEESETPRLPIRPHGG
PPTPTRPPPYSYEDTPGLPVAPELPSRP
NPPYPPRPQ
PRPPPRPET TMVPALPERPNMEMGG
PPPLPVRPQ VMDVAPPLPPREEVLA
PRRPPRPSQPLGAMSPHDPPSPPLASRP
TPRLPNRRL
LEIPNLPPRPSAPSAH
RRPIPPHPS XHLPGVPALPARPLAD
RTVPSRPFS
SYGPPLPMRPRVEGEW
GLLDHAPGPPLPMRPD
STLADRPFYPKYPPLPSRP
Yhr016c APYLPHSARMPEPPPPDLPIREQND
YQPSLPPRP DLYPKLPERPSSGWVT
Ysc84
PRLPQRPKM
PPYPPRYHQ
YQPLLPPRP
APPLPTRKR
XVPPLPPRP
HRPRLPRRP
QPSLPPRWR
PPKPPRRSQ
Bzz1-1 KKAPPPPRL
PKRAPPPTPSRYKAPPPPPTLDML
KKHPPPDLP
FYKPAPPPT
KKPPPPMPL
NKRKPPDIP
KARPPEPPA
XRXPPPSPP
Bzz1-2 KRPPPPFPP
RKPPPPTVPNo peptide selected
KRPPLPPRA
AFKPPPPPP
TRKLPPPPP
AKKGPPPRP
RKLPPPPVP
RRPPVPPRV
Yar014c No peptide selected
Yjl020cRRPPSPPVA
RKAPSPPSQDKPPPVPPRPGATRVD
Bbc1
YRLLRRSPGDP
PRLPLRPGQ
PRMPNRPRQ
PKVPRRPEL
PSIPPRPGL
PNIPRRPGL
PRLPTRPGE
PHLPPRPFR
PRTPARPRS
PKVPKRPTA
RTPPIPRRP
Ydl117wNo peptide selectedNo peptide selected
Cyk3
Yll017wLittle soluble domain
Ymr032wLittle soluble domain
Hof1
Cdc25No peptide selected
Fus1 NARSTSLNQ
GARTSSLSR
RQHRTASLG
RPRHSSFWA
RPRSTSLAL
RSPRSTSYA
YRLRTTSLV
RHHRVSSLS
RAARTTSLQ
RAKRTSSMQ
RGPRTTSNP
ARHERSSSL
Boi1IPPRSPRRLNo peptide selected
RPRNPARLA
VPPPRNPAR
RPRDPRRIQ
PPSIPRRL
TRAYPKIPL
RPRPLPPRP
RPRPLPANP
PQRSPRAVT
IPLRNPMRT
Boi2RPRNPARLA 4No peptide selected
RPRDPRRIQ
GPRHPGRIK
IPPRSPRRL
IPTRNPARV
IPLRNPMRT
PKRNPNRLS
PRRNPSRVS
Sho1RSRALPPLPSSLESKPLPPLPFDIY
YVKQLPRTP YYVKPLPSPPRWAALS
HNKKLPARP 3HNSSEKPLPPLPIANS
RSRPLPAIP
MSRPLPALP


View Supplemental Table 2


S6. Predicted SH3 Ligands

Supplemental Table 3. Predicted SH3 Ligands. Peptides whose score is within the top 20%, those within the top 15% occur above the line.

MYO3/5 PXXXPPXXP
PPPPPPPPPV 4.85 >YNL271C BNI1, Chr XIV fr
PPPPPPPPPS 4.85 >YMR109W MYO5, Chr XIII f
PPPPPPPPPS 4.85 >YDL146W YDL146W, Chr IV
PPPPPPPPPP 4.85 >YIL159W BNR1, Chr IX fro
PPPPPPPPPK 4.85 >YMR089C YTA12, Chr XIII
PPPPPPPPPG 4.85 >YLR337C VRP1, Chr XII fr
PPLPPPPPPQ 4.77 >YCL008C STP22, Chr III f
PKGPPPPPPP 4.69 >YPL277C YPL277C, Chr XVI
PKGPPPPPPP 4.69 >YOR389W YOR389W, Chr XV
PAPPPPPPPP 4.69 >YNL271C BNI1, Chr XIV fr
PPPPPPAPPA 4.62 >YNL138W SRV2, Chr XIV fr
PYYPPPPPGE 4.46 >YDR432W NPL3, Chr IV fro
PEIPPPLPPK 4.38 >YIL156W UBP7, Chr IX fro
PFVPPPNVPK 4.31 >YBR058C UBP14, Chr II fr
PPPPPPPPSR 4.23 >YDL146W YDL146W, Chr IV
PPPPPPPPGY 4.23 >YHR165C PRP8, Chr VIII f
PNEPPPPCPA 4.23 >YGL197W MDS3, Chr VII fr
PVPPPPVRPS 4.15 >YDL140C RPO21, Chr IV fr
PPLPPPLFPS 4.15 >YER033C YER033C, Chr V f
PLGAPPPPPH 4.15 >YMR280C CAT8, Chr XIII f
PLAPPPHGPF 4.15 >YIL055C YIL055C, Chr IX

PVLRPPPPPA 4.08 >YOR109W INP53, Chr XV fr
PVLPPPRSPN 4.08 >YER158C YER158C, Chr V f
PVAPPPPPAS 4.08 >YOR181W LAS17, Chr XV fr
PSWKPPDLPI 4.08 >YIL156W UBP7, Chr IX fro
PQLPPPKPKV 4.08 >YDR266C YDR266C, Chr IV
PQHLPPPPPP 4.08 >YOR329C SCD5, Chr XV fro
PTPPAPPAPP 4.03 >YJL020C BBC1, Chr X
PSSSPPPIPK 4.00 >YJL095W BCK1, Chr X from
PPYTPPMSPP 4.00 >YOL100W PKH2, Chr XV fro
PISFPPPPPM 4.00 >YGL173C KEM1, Chr VII fr
PDLLPPPPPP 4.00 >YPL063W YPL063W, Chr XVI
PAGIPPPPPL 4.00 >YIR006C PAN1, Chr IX fro

BOI1 PRXPXR

PPRSPNRNAH 4.14 >YDR239C YDR239C, Chr IV
PPRSPGRSPT 4.14 >YLR086W SMC4, Chr XII fr
FPRDPKRLRP 4.05 >YLL018C DPS1, Chr XII fr
PPRSPNRPTL 3.81 >YER158C YER158C, Chr V f
RPRMPKRQRI 3.76 >YMR125W STO1, Chr XIII f
RPRGPQRGKD 3.76 >YNL064C YDJ1, Chr XIV fr

BOI2 PRXPXR

PPRSPNRNAH 4.02 >YDR239C YDR239C, Chr IV
PPRSPGRSPT 3.99 >YLR086W SMC4, Chr XII fr
FPRDPKRLRP 3.78 >YLL018C DPS1, Chr XII fr

FUS1 R[ST][ST][ST]L
GRRPRSSSLQ 4.75 >YAL031C FUN21, Chr I fro
VRTRRTTSLV 4.33 >YMR140W YMR140W, Chr XII
GRAIRTSSLY 4.33 >YPL224C MMT2, Chr XVI fr
TRSERSSSLN 4.25 >YOL046C YOL046C, Chr XV
ERQMRSSSLD 4.08 >YDR206W EBS1, Chr IV fro

TLNPRSSSLA 4.00 >YPL156C YPL156C, Chr XVI
QVHRRTTSLA 4.00 >YGL128C YGL128C, Chr VII
MRPRRSSSLF 4.00 >YPL070W YPL070W, Chr XVI
SAHHRSSSLQ 3.92 >YDR379W RGA2, Chr IV fro
QYSKRTSSLP 3.92 >YKL105C YKL105C, Chr XI

Abp1 PXXPX[RK]P
SPSPSPLNPYRPHHN 4.33 >YNL298W CLA4, Chr XIV fr
IPPPPPPPPPKPPLN 4.33 >YMR089C YTA12, Chr XIII
DKSRPPRPPPKPLHL 4.33 >YIL095W PRK1, Chr IX fro
DKKTKPTPPPKPSHL 4.33 >YNL020C ARK1, Chr XIV fr
TEQNNPPKPQKPVPL 4.17 >YOR290C SNF2, Chr XV fro
TCLPVPPPPVRPSIS 4.17 >YDL140C RPO21, Chr IV fr
RQAIPPPVPNRPGGT 4.17 >YLR144C ACF2, Chr XII fr
PVLPPPRSPNRPTLS 4.17 >YER158C YER158C, Chr V f
NSKHAPFIPVKPALE 4.17 >YPR095C SYT1, Chr XVI fr
LFDDAPATPPRPLKR 4.17 >YJL194W CDC6, Chr X from
EEGPPPAMPARPTAT 4.17 >YBL007C SLA1, Chr II fro
TPRPNPTQPRKPLDC 4.00 >YDR359C YDR359C, Chr IV
TIPFLPVLPQKPGGV 4.00 >YDR178W SDH4, Chr IV fro
SSRTEPSTPSRPVPP 4.00 >YJL095W BCK1, Chr X from
SSCILPSTPTRPLSQ 4.00 >YPL202C YPL202C, Chr XVI
SPRPSPWLPSKPNCY 4.00 >YDR151C CTH1, Chr IV fro
SKSGPPPRPKKPSTL 4.00 >YNL138W SRV2, Chr XIV fr
RLQSQPPRPPRPAAN 4.00 >YGR268C YGR268C, Chr VII
PTSSQPRPPPRPQQN 4.00 >YGR268C YGR268C, Chr VII
PTGILPLAPLRPLDP 4.00 >YPL085W SEC16, Chr XVI f
PSEVTPKVPERPSRR 4.00 >YIR003W YIR003W, Chr IX

NBP2 RXXPXXP
PSRPAPKPPS 4.32 >YHL007C STE20, Chr VIII
PQRTAPKPPI 4.16 >YNL298W CLA4, Chr XIV fr
PKREAPKPPA 4.04 >YJL095W BCK1, Chr X from
PNRRAPRRPL 3.99 >YJL128C PBS2, Chr X from
YHRPAPKPPV 3.85 >YDL028C MPS1, Chr IV fro
PHRLAPSAPA 3.84 >YOL113W SKM1, Chr XV fro
PIRYAPGDPI 3.70 >YNL132W YNL132W, Chr XIV

SPRRAPKPPS 3.60 >YER114C BOI2, Chr V from
NGRSAPSPVR 3.50 >YGL013C PDR1, Chr VII fr

RVS167 Class I RX(LV)PXPP
RPVPPPPPMR 4.08 >YOR181W LAS17, Chr XV fr
RYLPAPPVCI 3.67 >YOR116C RPO31, Chr XV fr
RRVPLPPMAE 3.48 >YML058W SML1, Chr XIII f
RAVPILPPRN 3.47 >YBR108W YBR108W, Chr II

RVS167 Class 2 PX%PPR or PP%PXR %=hydrophobic
TSPPLPPRAD 4.80 >YMR192W YMR192W, Chr XII
SSPPLPPRQN 4.74 >YPL249C YPL249C, Chr XVI
GPPPLPPRAN 4.59 >YLR144C ACF2, Chr XII fr
PAPPPPPRRG 4.53 >YOR181W LAS17, Chr XV fr
IMPTLPPRPY 4.31 >YGL060W YGL060W, Chr VII
SPPPLPTRRD 4.27 >YPR171W YPR171W, Chr XVI
AAPPPPPRRA 4.25 >YCR088W ABP1, Chr III fr
AVPILPPRNN 4.15 >YBR108W YBR108W, Chr II
APPPLPNRQL 4.15 >YNL094W YNL094W, Chr XIV
LLPPLPERAY 4.13 >YGL144C YGL144C, Chr VII

SAPDIPPRSP 4.08 >YDR239C YDR239C, Chr IV
LPPPPPPRAQ 4.06 >YOR329C SCD5, Chr XV fro
EHPPLPARRK 3.99 >YOR042W YOR042W, Chr XV
EEPPLPKRIR 3.99 >YKL214C YKL214C, Chr XI
QGPGIPPRTY 3.96 >YPL084W BRO1, Chr XVI fr
PVPPPPVRPS 3.86 >YDL140C RPO21, Chr IV fr

SHO1 [RK]XLPXXP
YERPLPDLPS 3.84 >YKR027W YKR027W, Chr XI
KSRVLPPLPF 3.70 >YER032W FIR1, Chr V from
QNRPLPQLPN 3.66 >YOR181W LAS17, Chr XV fr
LTRPLPSTPN 3.57 >YOL070C YOL070C, Chr XV
VNKPLPPLPV 3.48 >YJL128C PBS2, Chr X from
RCRVLPATPR 3.36 >YKL086W YKL086W, Chr XI
LNRLLPNLPE 3.30 >YJR090C GRR1, Chr X from
IWRYLPAPPV 3.28 >YOR116C RPO31, Chr XV fr

FERILPILPV 3.25 >YOL081W IRA2, Chr XV fro
RSKPLPLTPN 3.21 >YCL027W FUS1, Chr III fr
NGRTLPPVPT 3.18 >YER064C YER064C, Chr V f
DNRLLPSWPK 3.14 >YIL047C SYG1, Chr IX fro
LFRSLPPHPA 3.11 >YCR022C YCR022C, Chr III

SLA1-3 RXXPXPP
YHRPAPKPPV 4.80 >YDL028C MPS1, Chr IV fro
TGRRGPAPPP 4.54 >YOR181W LAS17, Chr XV fr
VKRTPPLPPV 4.47 >YOL093W YOL093W, Chr XV
VERGPPYPPD 4.46 >YDR464W SPP41, Chr IV fr
TRRRPPPPPI 4.40 >YNL094W YNL094W, Chr XIV
KERRPPPPPP 4.38 >YLR425W TUS1, Chr XII fr
MSRSPPRPPS 4.34 >YDR243C PRP28, Chr IV fr
PQRTAPKPPI 4.26 >YNL298W CLA4, Chr XIV fr
LPRAPPVPPA 4.25 >YJL020C BBC1, Chr X from
SPRRAPKPPS 4.23 >YER114C BOI2, Chr V from
HHRETPPPPP 4.17 >YPL055C YPL055C, Chr XVI

EFRRVPLPPM 4.07 >YML058W SML1, Chr XIII f
ERRPPPPPPL 4.05 >YLR425W TUS1, Chr XII fr
TTRETPLPPI 4.02 >YPL207W YPL207W, Chr XVI
PSRPAPKPPS 3.97 >YHL007C STE20, Chr VIII
PPRRGPAPPP 3.97 >YOR181W LAS17, Chr XV fr
PERVKPAPPV 3.89 >YPR171W YPR171W, Chr XVI

YGR136W Class 1 RXR[YFLP]X[LP]P

RTRRRPPPPP 3.97 >YNL094W YNL094W, Chr XIV
RLRKRPPPPP 3.66 >YIL156W UBP7, Chr IX fro
IKRSRPPPPP 3.60 >YDR239C YDR239C, Chr IV
GARERMPLPL 3.55 >YPL262W FUM1, Chr XVI fr

LSRGRYGLPL 3.36 >YDR419W RAD30, Chr IV fr
LSRRRFSLPS 3.33 >YLR149C YLR149C, Chr XII
RLRKRLNLPS 3.27 >YOR155C YOR155C, Chr XV
RDRKRLSLPE 3.22 >YHL008C YHL008C, Chr VII

YGR136W Class 2 PX[IVLP]PXR

IMPTLPPRPY 4.09 >YGL060W YGL060W, Chr VII
QTPHVPDRPP 4.05 >YPR104C FHL1, Chr XVI fr
SAPDIPPRSP 4.03 >YDR239C YDR239C, Chr IV
VTPKVPERPS 3.98 >YIR003W YIR003W, Chr IX
HDPNIPLRPK 3.98 >YGR184C UBR1, Chr VII fr
SKPSVPPRNY 3.91 >YIL108W YIL108W, Chr IX
TSPPLPPRAD 3.89 >YMR192W YMR192W, Chr XII
SSPPLPPRQN 3.89 >YPL249C YPL249C, Chr XVI
IPPPVPNRPG 3.88 >YLR144C ACF2, Chr XII fr
ESPTVGPRPG 3.82 >YMR294W-A YMR294W-A, Chr
TSPKLPPRGK 3.76 >YPL249C YPL249C, Chr XVI
YNPTIPPRSK 3.68 >YOL070C YOL070C, Chr XV
KIPVVPPRET 3.66 >YGR166W KRE11, Chr VII f
EKPLLPTRPN 3.65 >YPR171W YPR171W, Chr XVI
QGPGIPPRTY 3.64 >YPL084W BRO1, Chr XVI fr
VNPFIPRRPY 3.63 >YDR409W YDR409W, Chr IV
DRPQLPPRQV 3.63 >YMR192W YMR192W, Chr XII
AVPILPPRNN 3.62 >YBR108W YBR108W, Chr II
AEPAISPRPV 3.62 >YNL243W SLA2, Chr XIV fr
QGPKIPWRCG 3.60 >YKR066C CCP1, Chr XI fro
PVPPPPVRPS 3.60 >YDL140C RPO21, Chr IV fr
PAPPPPPRRG 3.54 >YOR181W LAS17, Chr XV fr
WSPNIPLRYS 3.53 >YOL017W YOL017W, Chr XV
VIPPVPSRYS 3.53 >YDL117W YDL117W, Chr IV
SFPTIPLRAS 3.53 >YER006W YER006W, Chr V f
LKPDIPLRNM 3.53 >YGL224C YGL224C, Chr VII

ALPILPKREV 3.52 >YGL028C SCW11, Chr VII f
GPPPLPPRAN 3.50 >YLR144C ACF2, Chr XII fr
FNPAIPLRIY 3.50 >YLR073C YLR073C, Chr XII
GVPVVPSREV 3.49 >YER014W HEM14, Chr V fro
SQPRPPPRPQ 3.47 >YGR268C YGR268C, Chr VII
AQPPLPSRNV 3.47 >YCR088W ABP1, Chr III fr
SLPKLPFRSW 3.45 >YBR132C AGP2, Chr II fro
PAPPPPPRAS 3.45 >YOR181W LAS17, Chr XV fr
NSPDLPERTK 3.45 >YDL225W SHS1, Chr IV fro
LLPPLPERAY 3.45 >YGL144C YGL144C, Chr VII
AAPQLPSRSS 3.45 >YCR088W ABP1, Chr III fr
GQPPVPVRMQ 3.44 >YBR108W YBR108W, Chr II
SEPAIPYRET 3.42 >YNL163C YNL163C, Chr XIV
CIPDLPLRIH 3.42 >YCR087W YCR087W, Chr III
ELPSPPLRMV 3.41 >YER152C YER152C, Chr V f

BZZ1-1 KXXPPP or KXXPPXP

YKKAPPPSSG 4.16 >YDR376W ARH1, Chr IV fro
TKKAPPPVVK 4.09 >YBR108W YBR108W, Chr II
FKFPPPPNAH 4.03 >YDR293C SSD1, Chr IV fro
HKAPPPPPPT 4.00 >YOR181W LAS17, Chr XV fr
AKAPPPPPPP 4.00 >YDL146W YDL146W, Chr IV
RKRPPPPPPV 3.91 >YIL156W UBP7, Chr IX fro
PKKFPPPTPL 3.88 >YER172C BRR2, Chr V from
TKSPPPPPSP 3.86 >YLR337C VRP1, Chr XII fr
QKKIPPPFKP 3.86 >YHR205W SCH9, Chr VIII f
NKFAPPPKKS 3.86 >YCR088W ABP1, Chr III fr
PKGPPPPPPP 3.79 >YPL277C YPL277C, Chr XVI
PKGPPPPPPP 3.79 >YOR389W YOR389W, Chr XV
SKEAPPPVET 3.78 >YCR013C YCR013C, Chr III
PKHAPPPVPN 3.78 >YDL019C YDL019C, Chr IV
KKAAPPPVEK 3.74 >YGL122C NAB2, Chr VII fr
GKVRPPPTRK 3.74 >YDR421W YDR421W, Chr IV
VKAIPPPMMI 3.71 >YCR013C YCR013C, Chr III
KKPAPPPPGM 3.67 >YMR109W MYO5, Chr XIII f
GKTIPPPTRS 3.64 >YKR078W YKR078W, Chr XI
HKEIPPPQWP 3.63 >YLL048C YBT1, Chr XII fr
SKSGPPPRPK 3.59 >YNL138W SRV2, Chr XIV fr
EKWKPPPWWY 3.58 >YGR110W YGR110W, Chr VII
YKNFPPPFRK 3.57 >YGL142C GPI10, Chr VII f
MKTTPPPAPR 3.57 >YAR042W SWH1, Chr I from

PKSFPPPPLK 3.53 >YBR108W YBR108W, Chr II
VKVKPPPNSG 3.52 >YBR156C YBR156C, Chr II
GKTVPPPDFT 3.51 >YHR007C ERG11, Chr VIII
VKPRPPPNRA 3.50 >YMR196W YMR196W, Chr XII
RKTKPPPPLD 3.50 >YAL017W FUN31, Chr I fro
PKLVPPPPRT 3.47 >YNR039C YNR039C, Chr XIV
KKSVPPPRMM 3.45 >YJR021C REC107, Chr X fr
GKVSPPPIRN 3.45 >YPL150W YPL150W, Chr XVI
LKPKPPPKPL 3.42 >YNL020C ARK1, Chr XIV fr
FKELPPPSDP 3.42 >YDL108W KIN28, Chr IV fr
TKPTPPPAPE 3.41 >YMR205C PFK2, Chr XIII f
RKFQPPPGFK 3.38 >YER029C SMB1, Chr V from
TKPTPPPKPS 3.34 >YNL020C ARK1, Chr XIV fr

BZZ1-2 ++%P[LVP]P
KRPPPPPPVS 4.81 >YIL156W UBP7, Chr IX fro
RRRPPPPPIP 4.62 >YNL094W YNL094W, Chr XIV
RRPPPPPPLL 4.48 >YLR425W TUS1, Chr XII fr

HKAPPPPPPT 4.02 >YOR181W LAS17, Chr XV fr

Yhl002w RX%PX%P
PSRPAPKPPS 4.20 >YHL007C STE20, Chr VIII
YERPLPDLPS 4.05 >YKR027W YKR027W, Chr XI
IWRYLPAPPV 4.05 >YOR116C RPO31, Chr XV fr
QNRPLPQLPN 3.98 >YOR181W LAS17, Chr XV fr
YHRPAPKPPV 3.94 >YDL028C MPS1, Chr IV fro
AGRPIPPAPT 3.94 >YGR058W YGR058W, Chr VII
RKRPPPPPPV 3.92 >YIL156W UBP7, Chr IX fro
KSRVLPPLPF 3.89 >YER032W FIR1, Chr V from
AMRPIPPLPT 3.77 >YNL152W YNL152W, Chr XIV
DFRSLPKVPT 3.76 >YPR151C YPR151C, Chr XVI
PQRMMPPPPG 3.75 >YKL204W YKL204W, Chr XI
NGRTLPPVPT 3.71 >YER064C YER064C, Chr V f
STRPIPAIPM 3.70 >YJL133W MRS3, Chr X from
ERRPPPPPPL 3.67 >YLR425W TUS1, Chr XII fr
SLRVLPIAPK 3.65 >YDL231C YDL231C, Chr IV
NSRNIPPPPP 3.62 >YMR089C YTA12, Chr XIII
NPRNLPSVPN 3.59 >YLR418C CDC73, Chr XII f

LNRLLPNLPE 3.52 >YJR090C GRR1, Chr X from
FERILPILPV 3.48 >YOL081W IRA2, Chr XV fro

Yfr024c class 2 PXLPXR

EKPLLPTRPN 4.63 >YPR171W YPR171W, Chr XVI
EHPPLPARRK 4.50 >YOR042W YOR042W, Chr XV
IMPTLPPRPY 4.42 >YGL060W YGL060W, Chr VII
SSPPLPPRQN 4.37 >YPL249C YPL249C, Chr XVI
TSPPLPPRAD 4.33 >YMR192W YMR192W, Chr XII
LLPPLPERAY 4.23 >YGL144C YGL144C, Chr VII
STPPLPRRRA 4.20 >YGL181W GTS1, Chr VII fr
AQPPLPSRNV 4.20 >YCR088W ABP1, Chr III fr
SPPPLPTRRD 4.17 >YPR171W YPR171W, Chr XVI
EEPPLPKRIR 4.11 >YKL214C YKL214C, Chr XI
GPPPLPPRAN 4.09 >YLR144C ACF2, Chr XII fr
APPPLPNRQL 4.04 >YNL094W YNL094W, Chr XIV
KIPMLPSRRT 4.01 >YHL027W RIM101, Chr VIII
ASPTLPTRRS 3.95 >YDL156W YDL156W, Chr IV

AVPILPPRNN 3.91 >YBR108W YBR108W, Chr II
NSPDLPERTK 3.86 >YDL225W SHS1, Chr IV fro
LLPNLPMRTF 3.86 >YIL105C YIL105C, Chr IX
VPPNLPMRRF 3.85 >YNL047C YNL047C, Chr XIV
PLPQLPNRNN 3.82 >YOR181W LAS17, Chr XV fr
ALPILPKREV 3.77 >YGL028C SCW11, Chr VII f
KCPRLPHRNK 3.73 >YPR097W YPR097W, Chr XVI
TPPTLPPRRI 3.72 >YMR192W YMR192W, Chr XII
IAPSLPSRNS 3.71 >YCR088W ABP1, Chr III fr
AAPQLPSRSS 3.71 >YCR088W ABP1, Chr III fr

Yfr024c Class1 RX[IVL]PXXP
SRVLPPLPFP 4.29 >YER032W FIR1, Chr V from
TRPLPSTPNE 4.28 >YOL070C YOL070C, Chr XV
FRSLPPHPAC 4.28 >YCR022C YCR022C, Chr III
GRPIPPHPDA 4.27 >YJL042W MHP1, Chr X from
GRTLPPVPTQ 4.24 >YER064C YER064C, Chr V f
GRPIPPAPTH 4.22 >YGR058W YGR058W, Chr VII
ERPLPDLPST 4.22 >YKR027W YKR027W, Chr XI
SRPIPPTPSG 4.15 >YPL009C YPL009C, Chr XVI
MRPIPPLPTE 4.14 >YNL152W YNL152W, Chr XIV
DRNLPSHPSS 4.11 >YGR143W SKN1, Chr VII fr
NRPLPQLPNR 4.10 >YOR181W LAS17, Chr XV fr
PRNLPSVPNG 4.01 >YLR418C CDC73, Chr XII f
NRPVPPPPPM 3.95 >YOR181W LAS17, Chr XV fr
ERFLPNRPHY 3.94 >YPR117W YPR117W, Chr XVI
NRLLPSWPKR 3.91 >YIL047C SYG1, Chr IX fro
KRVLPSKPKK 3.88 >YLR183C YLR183C, Chr XII
SVPLPPQPLY 3.83 >YIL060W YIL060W, Chr IX
SIPLPPNPAT 3.83 >YPR197C YPR197C, Chr XVI
RRRLPDRPPN 3.83 >YGL163C RAD54, Chr VII f
TRFLPNHPGG 3.79 >YML054C CYB2, Chr XIII f
RRPVPRRPSQ 3.78 >YPR091C YPR091C, Chr XVI
LRVLPIAPKI 3.75 >YDL231C YDL231C, Chr IV
ERILPILPVE 3.72 >YOL081W IRA2, Chr XV fro
LRLLPWWPSL 3.71 >YJL083W YJL083W, Chr X f
DRSLPHFPKN 3.71 >YOR116C RPO31, Chr XV fr
SRNIPPPPPP 3.70 >YMR089C YTA12, Chr XIII
NRLLPNLPEE 3.66 >YJR090C GRR1, Chr X from

QRFLPTGPIA 3.65 >YGR255C COQ6, Chr VII fr
ARYLPQNPDI 3.65 >YBR195C MSI1, Chr II fro
KRLLPRDPSE 3.62 >YBR239C YBR239C, Chr II
ARKVPPIPTQ 3.61 >YPL249C YPL249C, Chr XVI
FRSLPKVPTT 3.59 >YPR151C YPR151C, Chr XVI
KRKLPGWPSA 3.56 >YIL165C YIL165C, Chr IX
TRPIPAIPMD 3.55 >YJL133W MRS3, Chr X from
TRYLPYFPIM 3.53 >YBL066C SEF1, Chr II fro
Ysc84 Class II PXLPXR
MPTLPPRPYI 4.68 >YGL060W YGL060W, Chr VII
KPLLPTRPNK 4.51 >YPR171W YPR171W, Chr XVI
QPDLPPRKIM 4.49 >YBR239C YBR239C, Chr II
SPPLPPRQNV 4.36 >YPL249C YPL249C, Chr XVI
SPPLPPRADC 4.36 >YMR192W YMR192W, Chr XII
SPKLPPRGKQ 4.36 >YPL249C YPL249C, Chr XVI
QPPRPPRPAA 4.32 >YGR268C YGR268C, Chr VII
VPILPPRNNV 4.26 >YBR108W YBR108W, Chr II
PPPLPPRANV 4.21 >YLR144C ACF2, Chr XII fr
QPPLPSRNVA 4.11 >YCR088W ABP1, Chr III fr
PPLLPPRNTM 4.11 >YJR083C YJR083C, Chr X f
LPPLPERAYI 4.09 >YGL144C YGL144C, Chr VII
PPTLPPRRIE 4.02 >YMR192W YMR192W, Chr XII
YPSLPERSKV 4.00 >YGR099W TEL2, Chr VII fr
SPDLPERTKL 4.00 >YDL225W SHS1, Chr IV fro
HPSLPVRTRF 4.00 >YOL033W MSE1, Chr XV fro
HPPLPARRKS 4.00 >YOR042W YOR042W, Chr XV
RPQLPPRQVV 3.99 >YMR192W YMR192W, Chr XII

TPPLPRRRAT 3.96 >YGL181W GTS1, Chr VII fr
APATPPRPLK 3.96 >YJL194W CDC6, Chr X from
LPKLPFRSWG 3.95 >YBR132C AGP2, Chr II fro
PPPLPTRRDH 3.94 >YPR171W YPR171W, Chr XVI
APSLPSRNSI 3.92 >YCR088W ABP1, Chr III fr
APRLPRRETS 3.92 >YIL061C SNP1, Chr IX fro
SPTLPTRRSR 3.91 >YDL156W YDL156W, Chr IV
LPILPKREVV 3.91 >YGL028C SCW11, Chr VII f
APTLPKRKNP 3.86 >YPR055W SEC8, Chr XVI fr
PPPLPNRQLP 3.85 >YNL094W YNL094W, Chr XIV
EPPLPKRIRI 3.84 >YKL214C YKL214C, Chr XI
LPTLPDRQLF 3.82 >YPL115C BEM3, Chr XVI fr
LPQLPNRNNR 3.82 >YOR181W LAS17, Chr XV fr
LPNLPMRTFK 3.82 >YIL105C YIL105C, Chr IX
IPQLPNRDEM 3.82 >YCR073C SSK22, Chr III f
DPILPRRTST 3.78 >YHL028W WSC4, Chr VIII f
CPRLPHRNKK 3.78 >YPR097W YPR097W, Chr XVI
PPQLPTRTKS 3.76 >YOR042W YOR042W, Chr XV

Ysc84 Class I RxLPx%P

KSRVLPPLPF 4.28 >YER032W FIR1, Chr V from
YERPLPDLPS 4.20 >YKR027W YKR027W, Chr XI
NNRPVPPPPP 4.09 >YOR181W LAS17, Chr XV fr
NGRTLPPVPT 4.08 >YER064C YER064C, Chr V f
NPRNLPSVPN 4.02 >YLR418C CDC73, Chr XII f
IWRYLPAPPV 3.87 >YOR116C RPO31, Chr XV fr
FERILPILPV 3.87 >YOL081W IRA2, Chr XV fro
LNRLLPNLPE 3.81 >YJR090C GRR1, Chr X from
DFRSLPKVPT 3.71 >YPR151C YPR151C, Chr XVI

Bbc1 Class1 ++XPXXP

KERRPPPPPP 4.17 >YLR425W TUS1, Chr XII fr
SPRRAPKPPS 3.94 >YER114C BOI2, Chr V from
TRRRPPPPPI 3.85 >YNL094W YNL094W, Chr XIV
SSRRAPIAPS 3.76 >YMR031W-A YMR031W-A, Chr
TGRRGPAPPP 3.72 >YOR181W LAS17, Chr XV fr
GRRRSPSTPI 3.63 >YNR047W YNR047W, Chr XIV
SSRRNPGKPP 3.59 >YGL041C YGL041C, Chr VII

RTRRRPPPPP 3.53 >YNL094W YNL094W, Chr XIV
SLRKPPNGPS 3.49 >YOR097C YOR097C, Chr XV
EFRRVPLPPM 3.45 >YML058W SML1, Chr XIII f
PPRRGPAPPP 3.43 >YOR181W LAS17, Chr XV fr

Bbc1 Class 2 PX%PXRP
PPVPNRPGGT 4.69 >YLR144C ACF2, Chr XII fr
PNIPLRPKEI 4.45 >YGR184C UBR1, Chr VII fr
PKVPERPSRR 4.41 >YIR003W YIR003W, Chr IX
PNMPKRPTNA 4.36 >YDL002C NHP10, Chr IV fr
PHVPDRPPSQ 4.32 >YPR104C FHL1, Chr XVI fr
PFIPRRPYSN 4.31 >YDR409W YDR409W, Chr IV
PAMPARPTAT 4.20 >YBL007C SLA1, Chr II fro
PGMPPRPHFI 4.17 >YNL045W YNL045W, Chr XIV
PTLPPRPYIT 4.16 >YGL060W YGL060W, Chr VII
PRPPPRPQQN 4.02 >YGR268C YGR268C, Chr VII
PLLPTRPNKA 4.01 >YPR171W YPR171W, Chr XVI

PPPPVRPSIS 3.82 >YDL140C RPO21, Chr IV fr
PLAPLRPLDP 3.82 >YPL085W SEC16, Chr XVI f

Ypr154w Class 1 [YF]XRP1064987P

YERPPQPPPA 3.88 >YOR161C YOR161C, Chr XV
FSRPIPPTPS 3.86 >YPL009C YPL009C, Chr XVI
YSRPSNPPPS 3.69 >YBR016W YBR016W, Chr II
YERPLPDLPS 3.61 >YKR027W YKR027W, Chr XI
YQRPMAPPPN 3.52 >YOR197W YOR197W, Chr XV
YSRPSAPPPG 3.51 >YDL012C YDL012C, Chr IV
YHRPAPKPPV 3.40 >YDL028C MPS1, Chr IV fro
v YSRPYVSNPL 3.29 >YBR208C DUR1,2, Chr II f
YNRPVYPPPQ 3.28 >YOR197W YOR197W, Chr XV
YSRPNTKAPL 3.24 >YKL009W MRT4, Chr XI fro

YPR154W Class II PP%PXR or PX%PXRP

PPPVPNRPGG 4.17 >YLR144C ACF2, Chr XII fr
HPPLPARRKS 4.04 >YOR042W YOR042W, Chr XV
IPPVPSRYSD 3.92 >YDL117W YDL117W, Chr IV
QPPRPPRPAA 3.88 >YGR268C YGR268C, Chr VII
LPPIPTRDDM 3.86 >YNL152W YNL152W, Chr XIV
SPPLPPRADC 3.80 >YMR192W YMR192W, Chr XII
LPPLPERAYI 3.79 >YGL144C YGL144C, Chr VII
PPPLPPRANV 3.77 >YLR144C ACF2, Chr XII fr
QPPVPVRMQP 3.72 >YBR108W YBR108W, Chr II
SPPLPPRQNV 3.70 >YPL249C YPL249C, Chr XVI
EPPLPKRIRI 3.69 >YKL214C YKL214C, Chr XI
PPPLPTRRDH 3.66 >YPR171W YPR171W, Chr XVI
TPKVPERPSR 3.59 >YIR003W YIR003W, Chr IX
TPHVPDRPPS 3.59 >YPR104C FHL1, Chr XVI fr
QPPLPSRNVA 3.56 >YCR088W ABP1, Chr III fr
DPNIPLRPKE 3.56 >YGR184C UBR1, Chr VII fr

RPPPPKRIRT 3.54 >YKL139W CTK1, Chr XI fro
TPPLPRRRAT 3.53 >YGL181W GTS1, Chr VII fr
APPPPPRRAT 3.49 >YCR088W ABP1, Chr III fr
QPPAPFRLRS 3.48 >YIL084C SDS3, Chr IX fro
PPAMPARPTA 3.48 >YBL007C SLA1, Chr II fro
MPTLPPRPYI 3.48 >YGL060W YGL060W, Chr VII
PPPLPNRQLP 3.46 >YNL094W YNL094W, Chr XIV
VPPPPVRPSI 3.44 >YDL140C RPO21, Chr IV fr
TPPAPSRSEK 3.38 >YBR108W YBR108W, Chr II
DPNMPKRPTN 3.38 >YDL002C NHP10, Chr IV fr
APPPPPRASR 3.37 >YOR181W LAS17, Chr XV fr


View Supplemental Table 4


View Supplemental Table 5