Supporting Online Material


Abstract
Full Text
Regulation of Cerebral Cortical Size by Control of Cell Cycle Exit in Neural Precursors
Anjen Chenn and Christopher A. Walsh

Supporting Online Material

Supplemental Figure 1.Hes1and Hes5 expression and expansion of precursor population in transgenic brains. In situ hybridization for Hes1 also labels cortical precursors in both wild type and transgenic E15.5 brains. In situ hybridization for Hes5 shows a similar pattern of labeling at E17.5 as it does at E15.5. Cortical surface area expansion causing severe cortical folding is also observed at E17.5. Bar, 1mm.


Medium version | Full size version


Methods
Transgenic Mice
Standard molecular biology techniques were used to generate the transgenic constructs. The 5' UTR from the rat insulin II gene was amplified from embryonic rat genomic DNA using the primers 5'TAAACGTCGACTAAGTGACCAGCTACAGTCGGAAA 3'and 5'TGTTAGGGCCCGTTGGAACAATGACCTGGAAGA 3' and subcloned directly upstream of the Greek Letter Beta-catenin cDNA. Transgenic mice in the FVB/N strain were generated by transgenic mouse cores at Children�s Hospital Boston and Brigham and Women�s Hospital.

Cell Culture and Luciferase Assays
NT2 cells were grown in DMEM/F12 with 10% fetal calf serum and 1 U/ml penicillin/streptomycin. Primary cortical cultures were generated from E14.5 embryos using minor modifications to the method described in (1). Cells were transfected using Lipofectamine 2000 following the manufacturer�s protocol (Life Technologies). Luciferase activity was determined 24-48 hours after transfection, using the Dual Light combined chemiluminescent system (Tropix), which allows the combined detection of Luciferase and Greek Letter Beta-galactosidase internal control for transfection efficiency.

Cell Proliferation, TUNEL, and Cell Cycle Exit Studies
To label proliferating cells, fetuses are exposed to BrdU by an intraperitoneal injection of the mother with 50mg/kg body weight BrdU. For simultaneous staining of Ki67 and BrdU, tissue was fixed with 4% paraformaldehyde and embedded in paraffin. Sections were deparaffinized with xylene, rehydrated through a series of ethanols, and boiled for 20 minutes in antigen-retrieval buffer (Vector labs). Sections were washed with PBS, and blocked with 5% donkey serum, 0.3% Triton X-100 in PBS for 30 minutes. Primary antibodies were incubated 2 hours, room temperature (BrdU (1:200, Harlan rat monoclonal), Ki67 (1:500, Novocastra rabbit polyclonal)). FITC and Cy3-coupled secondary antibodies (1:500, Jackson Immunoresearch) are used for double staining. Hoechst 33342 (1Greek Letter Mug/ml in PBS) is applied to sections for 5 min to highlight all nuclear DNA. BrdU and Ki67-labeled cells were counted from randomly determined sections through the cortex and percentages were compared by ANOVA followed by Neuman Keuls post hoc comparisons. For labeling index studies, 50 Ki67+ cells were identified first in each randomly chosen section, after which BrdU labeling was determined by switching to the other fluorescent channel. For cell cycle exit studies, a similar approach was used: in each randomly chosen field of view, 50 BrdU+ cells were chosen first, then Ki67 expression was determined. Fragmented DNA of apoptotic cells was labeled using a TUNEL assay following manufacturers protocols (Promega) with the following modifications: biotinylated nucleotide incorporated at the 3' end of damaged DNA was detected by streptavidin coupled Cy3. Cryostat sections were fixed with 4% paraformaldehyde and permeabilized with proteinase K (20Greek Letter Mug/ml, 10-30 min, room temp). The total number of apoptotic figures in the cortex was counted and normalized for tissue area and compared using ANOVA followed by Neuman Keuls post hoc comparisons.

Antibody Staining
10Greek Letter Mum cryosections are blocked with 5% donkey serum, 0.3% Triton X-100 in PBS for 30 min. Primary antibodies are diluted in blocking solution (TuJ1 (1:2000, Research Diagnostics rabbit polyclonal)). Peroxidase staining and counterstaining with Nuclear Fast Red using manufacturer�s protocol (ABC kit, Vector), or fluorescent secondary antibodies (1:500, Jackson Immunoresearch Labs) were used to visualize primary antibody binding.

In situ hybridization
In situ hybridization was performed by the In situ hybridization core at Beth Israel Deaconess Medical Center. Non-radioactive in situ hybridization was performed as described (2), using digoxigenin (DIG)-labeled cRNA probes (Probes were generated from the following: Reln 0.7kB from the 3' end of Reln cDNA sequence; Hes5: 992 bp full length cDNA, Hes1: 708 bp of 5' end (EcoR1-SmaI fragment) of Hes1cDNA; Tbr1: 264 bp of 3' UTR (3).


References and Notes
1. T. H. Murphy, M. Miyamoto, A. Sastre, R. L. Schnaar, J. T. Coyle, Neuron2, 1547 (1989).
2. U. V. Berger, M. A. Hediger, J. Comp. Neurol.433, 101 (2001).
3. A. Bulfone et al., Neuron15, 63 (1995).