Supporting Online Material


Abstract
Full Text
Myelin-Associated Glycoprotein as a Functional Ligand for the Nogo-66 Receptor
Betty P. Liu, Alyson Fournier, Tadzia GrandPré, Stephen M. Strittmatter

Supporting Online Material

Materials and Methods

Expression cloning of AP-NgR binding proteins. 45 pools of 5,000 independent clones from a mouse adult-brain cDNA library (Origene Tech., MD) were transfected into COS-7 cells and AP-NgR binding was assessed as described below. Positive pools were further subdivided and re-screened. In addition, PCR was used to identify positive pools which contained NgR.

Generation and purification of Fc and AP fusion proteins. To generate Fc-MAG and AP-MAG, clone 91 (sMAG) cDNA was used as a template for PCR amplification with the following primers: 5'GGCAATTGGGGGGCCACTGGGGTGCCTGGATG3' plus 5'GTGGTCGACTCAAGCACCCACAGGACCGATTTTGGC3' or 5'TCGCCAATTGACTTACCTGTAGGAGCACCCACAGGACCGATTTTGGC3' plus 5'TTGAAGCTTGCTAAACAAGATGATATTCCTCGCC3'.

DNA encoding residues 19 � 519 was amplified and ligated in frame with either the signal sequence-His6-AP sequence of pcAP6 as described for AP-Ng66 (1) or with the Fc sequence of pIG vector as previously described for Fc-L1 (2). To construct the AP-NgR vector, DNA encoding aa 27-451 was ligated into the pcAP6 vector as described above. All AP-tagged fusion proteins were produced by transient transfection of HEK293T cells and purified on Ni2++ resin (Invitrogen, CA). AP-Nogo 66, AP-NgR and AP-MAG binding to COS-7 cells are described below. Fc-MAG was purified on protein A agarose (Sigma, MO). Myc-tagged mouse wtNgR in pSecTagHygro (Invitrogen, CA) was used as a template for the NgR deletion mutants (3). Briefly, to generate Uppercase Greek Letter DeltaLRR and LRR-myc tagged expression vector, residues 57-310 or 310-445 were deleted using the ExSiteTM PCR-based site-directed mutagenesis kit (Stratagene, CA).

Cell binding assays utilizing AP fusion proteins.COS-7 cells were transfected with plasmid encoding either full length NgR or full-length sMAG. Thirty-six hours later, varying concentration of AP-MAG or AP-NgR were allowed to bind for 16 hours at 4°C or for 4-6 hours at 20°C. Washed cells were fixed with 3.7% formaldehyde in PBS for 15 minutes. Endogenous AP activity was heat inactivated at 67°C for 5-10 hours and bound AP fusion protein was assessed in the presence of nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Sigma, MO). For some experiments, wild type NgR was desialylated by incubation with 50mU of Vibrio cholera Greek Letter Alpha-2,3,6,8- neuraminidase (Calbiochem, CA) for 1 hour at 37°C before incubation with various AP fusion proteins for 4 hours at room temperature. Removal of GPI-anchored proteins was accomplished by treatment of cells with 1U/ml PI-PLC (Sigma, MO) for 1 hour at 37°C.

In vitro binding assay. Purified NgR-ecto (residues 27-310) was a generous gift from Biogen Inc., Cambridge, MA. Fc-MAG immobilized on protein A agarose was incubated with buffer alone or with NgR-ecto in the presence of 1% BSA for 1 hour and bound protein eluted with 0.1mM glycine, pH 3.0. NgR-ecto was also incubated with protein A agarose alone to rule out nonspecific binding to the affinity resin.

Microtiter well binding assay. 96 well plates were coated with 20 Greek Letter Mug/ml of goat anti-human IgG, Fc specific, (Sigma, MO) for 1-3 hours at room temperature, then washed and blocked with Hank�s Buffered Saline w/ 3% BSA overnight at 4°C. Fc-MAG at 10-100 ng/ml was absorbed for 1-2 hours at room temperature. Wells were washed and incubated with 10nM AP-NgR, AP-Ng66 or buffer for 1-2 hours at room temperature. AP fusion protein bound was assessed by the addition of p-nitro-phenyl phosphate as substrate and monitored over time.

Growth cone collapse assays. E7 and E13 chick DRG explants were isolated as previously described (4) and cultured for 10-12 hours. To remove GPI-linked proteins from E13 DRG axons, explants were treated with 1U/ml of PI-PLC (Sigma, MO) for 1 hour at 37°C. GST, GST-Ng66, IgG or Fc-MAG was added to the culture to a final concentration of 100 nM. After 30 minutes explants were fixed and stained with rodamine phalloidin to visualize growth cone morphology. HSV-Myc-NgR and HSV-GFP were prepared as described (1, 4). E7 DRG neurons were infected with these viruses for 24 hours prior to the addition of 100nM IgG or Fc-MAG for 30 minutes. Cells were fixed and stained as described above.

Neurite outgrowth assays. To test the dominant negative effects of NgR-Ecto on MAG function, dissociated neurons were plated on increasing concentration of inhibitory substrates (amino-Nogo or FcMAG) in the presence of NgR-ecto (500ng) or GST (500ng) as a control. In other experiments, NEP1-40 was added as a soluble inhibitor to cells plated on PBS, GST-Ng-66 or Fc-MAG. Neurons were then grown for 4-8 hours, fixed, stained with rhodamine phalloidin, and neurite outgrowth lengths were assessed using NIH image.


References and Notes

1. A. E. Fournier, T. GrandPre, S. M. Strittmatter, Nature409, 341 (2001).

2. E. Fransen etal., Hum Mol Genet 7, 999 (1998).

3. A. Fournier, G. Gould, B. P. Liu, S. M. Strittmatter, unpublished data.

4. T. Takahashi etal., Cell99, 59 (1999).