Report

U1-Mediated Exon Definition Interactions Between AT-AC and GT-AG Introns

See allHide authors and affiliations

Science  08 Nov 1996:
Vol. 274, Issue 5289, pp. 1005-1008
DOI: 10.1126/science.274.5289.1005

Figures

  • Fig. 1.

    (A) In vitro splicing of the SCN4A AT-AC intron. Time courses of in vitro splicing in HeLa cell nuclear extract (9) are shown for the SCN4A substrate (left), which includes the AT-AC intron 2, and for the control β-globin substrate (right), which includes the conventional intron 1. Capped, in vitro-transcribed, 32P-labeled SCN4A or β-globin pre-mRNAs were incubated under optimized conditions for the indicated times and analyzed by denaturing polyacrylamide gel electrophoresis and autoradiography (9). The structures and electrophoretic mobilities of the substrates, intermediates, and products are indicated on each side. An aberrantly spliced SCN4A mRNA arising from use of conventional cryptic 5′ and 3′ splice sites is indicated by an asterisk. (B) Schematic structure of the SCN4A pre-mRNA substrate, showing the nucleotide sequence surrounding the exon-intron boundaries. The exon and intron sizes in nucleotides are indicated at the top. Exon sequences are in uppercase, intron sequences in lowercase; the consensus elements are bold and underlined, and the presumptive branch indicated by a dot. The solid arrows show the 5′ and 3′ splice AT-AC cleavage sites and the open arrows show the conventional cryptic sites. Translation of the aberrant mRNA would result in frameshifting and premature termination within exon 3.

  • Fig. 2.

    Requirement of U12 snRNA for SCN4A AT-AC intron splicing. U2 or U12 snRNPs were inactivated by cleavage of their snRNA moieties with RNase H in the presence of complementary oligonucleotides. The nuclear extract was preincubated for 15 min in the absence of oligonucleotides (lanes 1 and 6) or in the presence of a U2-specific oligonucleotide (lanes 2, 3, 7, and 8) or a U12-specific oligonucleotide (lanes 4, 5, 9, and 10). The oligonucleotide concentration was 4.2 μM (lanes 2, 4, 7, and 9) or 8.4 μM (lanes 3, 5, 8, and 10). SCN4A (lanes 1 to 5) or β-globin pre-mRNAs (lanes 6 to 10) were added to the preincubated extracts and further incubated for 6 or 4 hours, respectively. The aberrant mRNA resulting from use of cryptic splice sites is indicated by an asterisk.

  • Fig. 3.

    Enhancement of SCN4A AT-AC intron splicing by U1 snRNA and a downstream 5′ splice site. (A) U1 (lanes 6 to 8 and 14 to 16), U2 (lanes 1 and 9), or U12 (lanes 2 to 4 and 10 to 12) snRNPs were inactivated by oligonucleotide-directed RNase H cleavage, as in Fig. 2. The oligonucleotide concentrations were 2.1 μM (lanes 1, 4, 9, and 12), 0.5 μM (lanes 3, 8, 11, and 16), 0.13 μM (lanes 2, 7, 10, and 15), or 0.03 μM (lanes 6 and 14). Control mock preincubations were done in the absence of oligonucleotides (lanes 5 and 13). SCN4A (lanes 1 to 8) or SCN4AM (lanes 9 to 16) pre-mRNAs were added to the preincubated extracts and further incubated for 6 hours. The aberrant SCN4A and SCN4AM mRNAs resulting from cryptic splice site activation are indicated by an asterisk. (B) Diagram of the 3′ end structures of the SCN4A pre-mRNA and of the SCN4AM mutant derivative. The nucleotide sequence of the wild-type intron 3 conventional 5′ splice site and the mutant sequence are indicated. The natural sequence is a perfect match to the conventional 5′ splice site consensus.

Tables

  • Table 1.

    Compilation of known AT-AC introns. P120, proliferating cell nucleolar antigen; CMP, cartilage matrix protein; SCN4A, voltage-gated skeletal muscle (type IV) sodium channel α subunit; also conserved in the rat homolog (6); SCN5A, voltage-gated cardiac sodium channel α subunit (6); CDK5, neuronal cyclin-dependent kinase (6); Rep-3, homolog of the bacterial DNA mismatch-repair protein MutS; Prospero, Drosophila homeodomain protein involved in neurogenesis. Intron sequences are shown in lowercase, flanking exon sequences in uppercase, and conserved sequence elements in bold. The dots indicate sequences that are either not shown or not known. The dashes denote 13 nt of the SCN4A intron 21, which are not shown. The question marks indicate that the corresponding sequences have not been determined or that the size of the intron is not yet known. The distance between the presumptive branch adenosine and the 3′ splice junction varies from 9 to 12 nt in the examples shown, except in intron 21 of SCN4A, where it is predicted to be 21 nt. For conventional metazoan introns, the usual distance is 18 to 40 nt, although in some cases it can be 150 nt (1).

    SpeciesGeneIntron number5′ splice site Presumptive 3′ splice site branch site*Size (nt)
    HumanP1206GG atatcctt…gttccttaGraphicc aggcccac AT99
    HumanCMP7GC atatcctt…tctccttaactctgagtccac TG644
    HumanSCN4A2GC atatcctg…tttccttgac cctgccccac GC126
    HumanSCN5A3TC atatcc…? …cccacgcac GC?
    HumanSCN4A21AG atgagtat…tcaacctgac—actatac TT800
    HumanSCN5A25AG atacgt…? …tctttgcac TT?
    MouseCDK59CG atatcctc…? …acatggacac AC440
    MouseREP-36AG atatcctt…tttctttaat cattactac AT?
    FlyProspero2CT atatcctt…aatccttgac tcctttgcac TC?
    AT-AC consensusatatcct tccttrGraphicc yac
    GT-AG consensusAG gtaagt ynytrGraphicy y11nyag GT
    • * The underlined a is the branch nucleotide; in the case of AT-AC introns i has only been mapped so far for the human P120 intron 6 (13).

    • † Previously compiled in (5); the corresponding AT-AC introns are also present in dog, mouse, and monkey P120, and in chicken CMP (5).