Report

Defective LPS Signaling in C3H/HeJ and C57BL/10ScCr Mice: Mutations in Tlr4 Gene

See allHide authors and affiliations

Science  11 Dec 1998:
Vol. 282, Issue 5396, pp. 2085-2088
DOI: 10.1126/science.282.5396.2085

Abstract

Mutations of the gene Lps selectively impede lipopolysaccharide (LPS) signal transduction in C3H/HeJ and C57BL/10ScCr mice, rendering them resistant to endotoxin yet highly susceptible to Gram-negative infection. The codominantLps d allele of C3H/HeJ mice was shown to correspond to a missense mutation in the third exon of the Toll-like receptor-4 gene (Tlr4), predicted to replace proline with histidine at position 712 of the polypeptide chain. C57BL/10ScCr mice are homozygous for a null mutation of Tlr4. Thus, the mammalian Tlr4 protein has been adapted primarily to subserve the recognition of LPS and presumably transduces the LPS signal across the plasma membrane. Destructive mutations of Tlr4 predispose to the development of Gram-negative sepsis, leaving most aspects of immune function intact.

Conservative estimates hold that in the United States alone, 20,000 people die each year as a result of septic shock brought on by Gram-negative infection (1). The lethal effect of a Gram-negative infection is linked, in part, to the biological effects of bacterial lipopolysaccharide (endotoxin), which is produced by all Gram-negative organisms. A powerful activator of host mononuclear cells, LPS prompts the synthesis and release of tumor necrosis factor (TNF) and other toxic cytokines that ultimately lead to shock in sepsis. Nonetheless, it is clear that timely recognition of LPS by cells of the innate immune system permits effective clearance of a Gram-negative infection before it becomes widely disseminated (2, 3).

More than 30 years ago, mice of the C3H/HeJ strain were found to have a defective response to bacterial endotoxin (4–8). Inquiry into the genetic basis of LPS resistance revealed a single locus (Lps), wherein homozygosity for a codominant allele (Lps d) was responsible for the endotoxin-unresponsive state. The Lps dmutation arose in mice of the C3H/HeJ substrain and became fixed in the population during the early 1960s (9). In contrast to C3H/HeJ mice, substrains C3H/HeN and C3H/OuJ (Lpsn homozygotes), which diverged from the same stock as C3H/HeJ mice, exhibit vigorous responses to LPS.

A second mutation preventing responses to endotoxin was identified in mice of the strain C57BL/10ScCr (10–12); animals of the control strain C57BL/10ScSn are normally responsive. The allelic nature of the C3H/HeJ and C57BL/10ScCr mutations was indicated by the observation that F1 animals produced by the cross C57BL/10ScCr × C3H/HeJ are as unresponsive as individuals of the C3H/HeJ parental strain (10). But significantly, heterozygotes produced by the cross C57BL/10ScCr × C57BL/10ScSn are as responsive to LPS as the normal (C57BL/10ScSn) parent (10), indicating that the C57BL/10ScCr allele is not codominant, but is strictly recessive to the common wild-type allele.

Speculations regarding the protein that is affected by mutations ofLps have, for the most part, posited that the LPS signal transduction apparatus is disrupted. Ulevitch, Tobias, Wright, and co-workers showed that LPS is concentrated from the plasma by lipopolysaccharide binding protein (LBP), and that the genetically unlinked plasma membrane protein CD14 is the principal receptor for LPS on the surface of mononuclear cells (13–15). Deletion of the CD14 gene substantially increases the concentration of LPS required for a biological response (16). However, because CD14 lacks a cytoplasmic domain, it has been postulated that a coreceptor for LPS must permit transduction of the signal across the plasma membrane. Several protein kinase cascades are known to become activated by LPS (17–21), ultimately leading to the production of TNF and other cytokines that mediate LPS effects (22, 23). However, direct biochemical, immunologic, and expression cDNA cloning approaches have failed to identify the genetic lesions in endotoxin-resistant mice.

In 1978, the Lps locus was mapped to mouse chromosome 4 and shown to occupy a position between the Mup-1 andPs loci (24, 25). Our own genetic and physical mapping data (26) identified two limiting genetic markers (B and 83.3) that were separated fromLps d by, respectively, four crossovers in a panel of 1600 meioses and three crossovers in a panel of 493 meioses.

A minimal contig, consisting of 20 bacterial artificial chromosome (BAC) clones and one yeast artificial chromosome (YAC) clone, was analyzed by sequencing. Nearly 40,000 reads were obtained from shotgun-cloned genomic DNA, bringing over 1.6 Mb of the central contig to a near-contiguous state and yielding dense coverage of >95% of the entire critical region. BLAST searches (27) performed on masked versions of the sequence disclosed dozens of high-scoring homologies with published expressed sequence tags (ESTs), but these were excluded from consideration as they could not be cloned from macrophage or fetal cDNA libraries of reliable complexity. Several pseudogenes were observed, but were dismissed because they were found to be fragmentary. GRAIL analyses, performed on long, contiguous sequences of the central contig with the program X-GRAIL (28), revealed an abundance of retroviral repeats and scattered nonretroviral exons, many of which proved to be derived from pseudogenes.

Only two authentic genes (a portion of the Pappa locus and the complete Tlr4 locus) were identified in the entire region, each by BLAST analysis and by GRAIL analysis (Fig. 1). Pappa encodes a secreted metalloproteinase and is not expressed by primary macrophages or macrophage cell lines (29). These considerations, as well as its extreme proximity to marker B, made it seem a poor candidate.Tlr4 seemed an excellent candidate, both on the grounds of map position and because the proinflammatory interleukin-1 (IL-1) receptor, like Tlr4, is a member of the Toll receptor family. Further, a human mutation causing coresistance to LPS and IL-1 (30) attests to the likelihood that the IL-1 and LPS use structurally related receptors.

Figure 1

Diagram of a small portion of the 2.6-Mb contig spanning the Lps critical region, described elsewhere in its entirety along with the sequences of primer pairs used to amplify markers (26). Centromere is to the left. Three BACs (49K20, 309I17, and 152C16; Research Genetics designations) contain fragments of Pappa (49K20) and the complete Tlr4 gene (309I17 and 152C16). Each BAC is ∼150 kb long. The orientation and exonic composition of the genes identified is schematically correct, but for clarity, the genes are drawn at far higher magnification than the BACs. Dots to the left of the three Pappa exons that were identified in K20 indicate that the gene continues to the left of the contig [other exons were detected in BACs 131M6, 216C14, and 358P4 (29]. Genetic mapping data (number of crossovers per number of meioses examined) are bracketed above the two genetic markers nearest to the Lps d (B and D4MIT178).

Accordingly, we cloned the Tlr4 cDNAs from C3H/HeJ mRNA and from the mRNA of several LPS-responsive strains of mice (including C3H/HeN) by reverse transcriptase–polymerase chain reaction, using primers derived from the genomic sequence. A single mutation (the presence of an A instead of a C) was observed at position 2342 of the C3H/HeJ Tlr4 cDNA sequence (GenBank accession number AF095353). This mutation lies within the coding region: At position 712 (within the cytoplasmic domain), a histidine is predicted to occur in the Tlr4 protein of C3H/HeJ mice, whereas LPS-responsive mice, rats, and humans display a proline in this position (Fig. 2) (31). The same mutation was identified in C3H/HeJ genomic DNA, but not in genomic DNA from C3H/HeN mice or mice of any other strain examined (29).

Figure 2

TheLps d allele represents a missense mutation affecting the cytoplasmic domain of Tlr4. Reverse transcription of mRNA isolated from mouse peritoneal macrophages was followed by PCR with the primers TTCTAACTTCCCTCCTGCGAC and CCTCTTCTCCTTCAGATTAAAG, which amplify the entire coding region of the mouse Tlr4 cDNA, yielding a product 2951 nucleotides (nt) long. The open reading frame of the mouse Tlr4 cDNA predicts a protein that is 835 amino acids long. The mutation, at position 712, lies in the most conserved portion of the Tlr4 sequence and is located within the cytoplasmic domain. Dots below the sequence indicate residues that vary between species. The Pro→His substitution that distinguishes Tlr4 of C3H/HeJ mice is boxed. Abbreviations for the amino acid residues are as follows: A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, Ile; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; and Y, Tyr.

Although the Tlr4 cDNA was readily amplified by RT-PCR from macrophage RNA derived from C3H/HeJ, C3H/HeN, and C57BL/10ScSn mice, it could not be amplified from macrophage RNA derived from C57BL/10ScCr mice. In contrast, a low-abundance control cDNA (32) could be readily amplified from all strains (Fig. 3A). Moreover, the Tlr4 mRNA could be detected on Northern (RNA) blots prepared with total RNA derived from macrophages of C57BL/10ScSn mice but not C57BL/10ScCr mice (Fig. 3B).

Figure 3

C57BL/10ScCr mice fail to express Tlr4 mRNA. (A) RT-PCR was carried out with the primers TGTCCCAGGGACTCTGCGCTGCCAC and GTTCTCCTCAGGTCCAAGTTGCCGTTTC, predicted to yield a product 2596 nt long. As a positive control, a fragment from the central portion of the low-abundance, 5.1-kb transferrin receptor (Tfr) mRNA was amplified from the same cDNA preparation, with primers from the Marathon amplification kit (Clontech, Palo Alto, California). Complementary DNA from C3H/HeJ, C3H/HeN, SWR, and C57BL/10ScSn macrophages yielded the expected 2.6-kb Tlr4 amplification product with 35 cycles of amplification, whereas cDNA from C57BL/10ScCr mice did not yield any product. All cDNA samples yielded the expected 0.3-kb product when amplified with Tfr control primers. (B) A Northern blot of total macrophage RNA obtained from C57BL/10ScCr and C57BL/10ScSn mice reveals that the nonresponder strain produces no detectable Tlr4 mRNA. RNA was separated in a 1.2% agarose gel, transferred to a nylon membrane (Magnagraph; Micron Separations Westborough, Massachusetts), and probed with a genomic DNA fragment from the third exon, corresponding to the region between nt 844 and 2641 of the mouse Tlr4 cDNA sequence (GenBank accession numberAF095353). Two bands are consistently detected on Northern blots of control (C57BL/10ScSn) mice (left) and on Northern blots prepared with RNA from mice of other strains (29). C57BL/10ScCr RNA yields no signal, even with prolonged exposure. The ethidium-stained gel is shown in the panel on the right.

Because a definable mutation exists within Tlr4 in C3H/HeJ mice, and complete absence of Tlr4 mRNA expression is observed in C57BL/10ScCr mice, it is apparent that Lps is identical to Tlr4. Certain inferences may thus be drawn from the phenotypes that result from distinct allelic combinations ofLps.

The null allele of Lps represented in C57BL/10ScCr mice behaves as a recessive mutation (10). Hence, the presence of a single wild-type Tlr4 allele (Tlr4Lps-n/θ) is sufficient to permit normal LPS signal transduction. By contrast, the mutation of C3H/HeJ mice is codominant, in the sense thatTlr4Lps-n/Tlr4Lps-d heterozygotes show intermediate levels of endotoxin response (7). Thus, the Pro→His point mutation exerts a dominant negative effect on LPS signal transduction.

A single copy of the Lps d allele (Tlr4Lps-d/θ) yields a phenotype as unresponsive as two copies (Tlr4Lps-d /Tlr4Lps-d ) (10). This fact is consistent with the notion that LPS signal transduction proceeds directly through the Tlr4 molecule, and tends to detract from the alternative hypothesis that Tlr4 undergoes interaction with a second plasma membrane protein that acts, in turn, as an LPS signal transducer.

Tlr4 mRNA is reportedly expressed predominantly in lymphoid tissues (33). Our own data (29) are in agreement with this finding, but in addition (Fig. 4) suggest that the Tlr4 mRNA is strongly and transiently suppressed by LPS in RAW 264.7 cells (34). As such, down-regulation of Tlr4 mRNA may contribute to endotoxin tolerance (35). It remains to be seen whether species-dependent variation in LPS responses, and modulation of LPS sensitivity by steroids, interferon-γ, and other agents, may be traced to the Tlr4 protein.

Figure 4

Induction of RAW 264.7 cells by LPS suppresses expression of Tlr4 mRNA. Cells (∼106) were induced with LPS at a concentration of 100 ng/ml for the period indicated. Cells were disrupted by NP40 lysis, nuclei were removed by sedimentation, and cytoplasmic RNA was extracted with SDS and phenol. The Tlr4 mRNA was detected on Northern blot with the 1.5-kb fragment described in Fig. 3. Tlr4 mRNA concentration declined upon LPS stimulation, before approaching preinduction levels. The ethidium-stained gel is shown in the panel on the right.

LPS signal transduction via Tlr4 has not previously been observed in any experimental system. However, it has recently been reported that human Tlr2 cDNA transfected into 293 cells can promote LPS signal transduction, given coexpression of CD14 (36). The present study excludes an independent role for Tlr2 in LPS signal transduction. The demonstration that Lps is identical to Tlr4effectively proves that Tlr4 is essential for LPS signaling. And in mice that lack Tlr4 (for example, C57BL/10ScCr animals), endogenously expressed Tlr2 does not contribute appreciably to LPS signal transduction, which fails to occur at measurable levels despite the presumption that the Tlr2 locus is intact. Although Tlr2, like Tlr4, might be required for LPS signaling, the available data are not sufficient to sustain this conclusion.

In Drosophila, the Toll signaling pathway culminates in activation of the drosomycin gene and is required for effective protection against fungal infection (37). Several homologs of the prototypic gene Toll exist in Drosophila, including 18-wheeler (38, 39), which facilitates the antibacterial response of flies (40). In mice, Tlr4 appears to have been retained chiefly to serve the LPS response pathway. Hence, C3H/HeJ and C57BL/10ScCr mice are developmentally and immunologically normal, aside from their inability to respond to LPS and to counter Gram-negative infection. CD14, the best-characterized cell surface receptor for LPS, is also a member of the Toll superfamily. It is conceivable that it directly engages Tlr4 upon interaction with LPS, thereby inducing signal transduction through the latter protein.

Hu and co-workers (41) have recently adduced evidence to suggest that, in birds, distinct allelic forms of Lpsinfluence survival during Gram-negative infection. It is possible that mutations of human Tlr4 also affect susceptibility to Gram-negative infection, or its clinical outcome.

  • * Present address: Northwestern University, 2300 Children's Plaza, No. 209, Chicago, IL 60614–3394, USA.

  • Present address: University of Texas Southwestern Medical Center, Department of Pharmacology, Dallas, TX 75235–9041 USA.

  • Present address: Millennium, Inc., Cambridge, MA 02139–4815, USA.

REFERENCES AND NOTES

View Abstract

Stay Connected to Science

Navigate This Article