Supplemental Data


Abstract
Full Text
A Role for Skin γδ T Cells in Wound Repair
Julie Jameson, Karen Ugarte, Nicole Chen, Pia Yachi, Elaine Fuchs, Richard Boismenu, and Wendy L. Havran

Supplementary Material


Supplementary details of experimental procedures

Wounding and Wound Closure Measurement: Epidermal wounding was performed as previously described by excising skin and panniculus carnosus (8). 3mm wounds were made in the ears or 4 wounds on the upper backs of mice 3-5 months of age. Mice were monitored daily for 20 days post wounding. At each timepoint the diameter of the wounds were measured three times by at least two investigators and percent of wound open was calculated. In each experiment, at least 2 wounds on 3 individual mice were measured at each timepoint per mouse strain. SEM is designated by error bars. In some cases epidermal sheets were isolated as previously described (28). All mice were on the C57Bl/6 background.

BrdU Incorporation: For proliferation experiments, 250 mg/kg BrdU was injected intraperitoneally at various days post-wounding. After two hours, mice were sacrificed and the complete wounds including 2 mm of the epithelial margins were excised and immediately frozen in OCT compound or fixed and embedded in paraffin. Sections were stained with hematoxylin and eosin or anti-BrdU Ab followed by biotinylated anti-Ig, peroxidase-conjugated streptavidin, and DAB. Wounds from over 50 C57Bl/6 and 40 TCRδ-/- mice were embedded for histological analysis and BrdU immunostaining. The number of BrdU+ cells was quantified under 200X magnification and wounds from at least 6 individual mice were quantified from each mouse strain per timepoint. Standard deviation is designated by error bars. Representative data is shown.

DETC Isolation: DETC were isolated from murine skin as previously described (3, 4, 29). In some experiments, epidermal cells were stained with the Thy 1.2 mAb (Pharmingen, La Jolla, CA) and purified DETC isolated by FACS sorting.

RT-PCR: Total RNA extracts were performed in TRIzol reagent (Life Technologies). Total RNA was extracted and 1 μg was used for reverse transcription with oligo dT(Life Technologies, Rockville MD). PCR was performed as previously reported (4). β-actin specific primers were used as an internal control. Primers used to amplify FGF-7 were 5' CGGAATTCATGCGCAAATGGATACTGACACGG 3' and 5' CGGAATTCTTAGGTTATTGCCATAGGAAG 3' resulting in a 550-base pair amplified product. FGF-10 primers were 5' ATGTGGAAATGGATACTGACACAT 3' and 5' CTATGTTTGGATCGTCATGGGG 3' resulting in a 630-base pair amplified product. The DETC cell line 7-17 was activated with Con A and used as a positive control.

Skin Organ Culture: 10-20 mm2 sections of skin that include the wound were excised and placed on Gelfoam (Savmart Pharmaceuticals, San Diego, CA) in Dulbecco's modified Eagle's medium or RPMI-1640 (Gibco) with 10% heat-inactivated bovine serum. In some experiments 20 U/ml of rIL-2 (BRMP. National Cancer Institute) was added to cultures. Fresh media was added every other day. In some experiments, 50 μg/ml of FGF-7 (Amgen, Thousand Oaks, CA) or 1 � 106 7-17 DETC cells, previously activated with Con A, were added to the cultures. Following 2 days of culture, 100 μg/ml BrdU was added to the cultures for 3-4 hours. Wounded tissue was embedded in paraffin and analyzed for BrdU incorporation by immunohistochemistry.