Supplemental Data


Abstract
Full Text
Reversion of B Cell Commitment upon Loss of Pax5 Expression
Ingvild Mikkola, Barry Heavey, Markus Horcher, and Meinrad Busslinger

Supplementary Material


Materials and Methods

Mutant mice. Pax5+/-, Pax5F/F, RAG2-/- and CreED-30 mice were maintained on the C57BL/6x129/Sv background and genotyped as described (S1, S2, S3, S4).

Pro-B cell culture. B220+ pro-B cells were sorted from the bone marrow of Pax5+/-or Pax5F/FCreED-30 mice and cultured on Greek Letter Gamma-irradiated ST2 cells in IL-7 containing IMDM medium as described (S5). Pax5+/- pro-B cell clones were generated by sorting single cells from a CD19-Pax5+/- pro-B cell pool with a FACSVantage TSO flow-cytometer (Becton-Dickinson).

Antibodies and flow cytometry. Single-cell suspensions were stained and analyzed on a FACSCalibur flow-cytometer (Becton-Dickinson) as described (S1). The following fluorescein isothiocyanate (FITC)-, phycoerythrin (PE)- or allophycocyanin (APC)-labeled antibodies were purchased from PharMingen (San Diego, CA): anti-B220 (RA3-6B2), anti-CD4 (L3T4), anti-CD8 (53-6.7), anti-CD19 (1D3), anti-Mac-1 (M1/70), anti-IgM (M41.42), anti-TCRGreek Letter Beta (H57-597) and anti-human CD2 (RPA-2.10) antibodies. The PE-anti-F4/80 (C1:A3-1) antibody were obtained from Serotec (Oxford, England). Greek Letter Beta-Galactosidase activity was measured by loading the pro-B cells with the fluorogenic substrate 5-chloromethylfluorescein di-Greek Letter Beta-D-galactopyranoside (CMFDG, Molecular Probes) as described (S6).

Kinetic analysis of Cre-mediated Pax5 inactivation. B220+ pro-B cells were sorted from the bone marrow of 4-week-old Pax5F/FCreED-30 mice, expanded in vitro and then treated with 1 Greek Letter MuM 4-hydroxy-tamoxifen (OHT; Research Biochemicals International, Natick, MA) for 3 days followed by subsequent culturing in the absence of OHT. The CD19-Pax5Uppercase Greek Letter Delta/Uppercase Greek Letter Delta pro-B cells were purified to homogeneity by eliminating the few non-deleting CD19+Pax5F/F pro-B cells by FACS sorting. The kinetic experiments were performed with freshly isolated Pax5F/FCreED-30 pro-B cells that were expanded ex vivo to 30x106 cells for only 9 days prior to OHT treatment as described above. Pro-B cells (6.5x106) were withdrawn at daily intervals after OHT addition. DNA isolated from 0.5x106 cells was analyzed by PCR genotyping (S2) to confirm deletion of Pax5 exon 2. Total RNA was prepared from 5x106 cells, using the Trizol Reagent (Gibco-BRL, Life Technologies). Reverse transcription (with random hexamer primers) and semiquantitative PCR were performed as described (S2, S6). The PCR products were separated on agarose gels and visualized by ethidium bromide staining. The primer sequences used for RT-PCR analysis are shown below in table S1. Protein samples were prepared by directly dissolving and boiling 1x106 cells in 80 Greek Letter Mul of 2x SDS sample buffer. Total protein (10 Greek Letter Mul) was separated by 10% SDS-PAGE and analyzed by Western blotting with a rabbit polyclonal antibody directed against the Pax5 paired domain (S7).

In vitro macrophage differentiation. Pax5Uppercase Greek Letter Delta/Uppercase Greek Letter Delta pro-B cells were cultured on ST2 cells in the absence of IL-7 for ~10 days followed by terminal differentiation in IMDM medium containing M-CSF (25 ng/ml; R&D Systems). The phagocytic activity of differentiated cells was determined by incubation with FITC-labeled heat-inactivated E. coli (Molecular Probes) as described (S8).

Pro-B cell transfer into RAG2-/- mice. RAG2-/- mice at 8-12 weeks of age were Greek Letter Gamma-irradiated with 550 rad and intravenously injected with 1-5x106in vitro cultured Pax5Uppercase Greek Letter Delta/Uppercase Greek Letter Delta, Pax5F/F or Pax5+/- pro-B cells as described (S9). Prior to injection, the Pax5+/- pro-B cells were infected with the pMI retrovirus expressing a human CD2 protein lacking its intracellular domain (S10).


Supplemental Figure 1. Acquisition of the T-lymphoid potential within 4 days after Pax5 inactivation. (A) Experimental outline for the generation of Pax5Uppercase Greek Letter Delta/Uppercase Greek Letter Delta pro-B cells. Cre-mediated deletion of the floxed Pax5 exon 2 was achieved by infection of Pax5F/Fpro-B cells with the retrovirus MSCV-Cre-GFP (a kind gift from D. Littman). This retrovirus expressed the Cre gene from the virus LTR promoter and the GFP gene from an internal phosphoglycerate kinase (PGK) promoter. (B) Flow cytometric analysis. Three weeks after pro-B cell transfer, the thymus and spleen of reconstituted mice were analyzed by flow cytometry with the indicated antibodies. The CD4/CD8 expression pattern is shown for the gated Ly5.2+ thymocytes. Day 4 refers to the time after retroviral infection, when the Pax5Uppercase Greek Letter Delta/Uppercase Greek Letter Delta pro-B cells were injected into RAG2-/- Ly5.1 mice. Non-deleted Pax5F/Fpro-B cells (day 0 prior to viral infection) were injected as control cells into RAG2-/- Ly5.1 mice. These experiments demonstrate that the Pax5Uppercase Greek Letter Delta/Uppercase Greek Letter Delta pro-B cells regained the T-lymphoid potential already within 4 days and thus irrespective of the duration of in vitro culturing following Pax5 inactivation.

Download Supplemental Figure 1 [PDF File]


Supplemental Figure 2. Acquisition of the T-lymphoid potential within 4 days after Pax5 inactivation. (A) Experimental outline. Cre-mediated deletion of the floxed Pax5 exon 2 was induced in Pax5F/FCreED-30 pro-B cells by 4-hydroxy-tamoxifen (OHT) treatment for 3 days. The treated pro-B cells were further cultured in the presence of IL-7 and ST2 cells and intravenously injected into RAG2-/- Ly5.1 mice at day 4 and day 15 after the first addition of OHT. (B) Flow cytometric analysis. Three weeks after pro-B cell transfer, the thymus and bone marrow of reconstituted mice were analyzed by flow cytometry with the indicated antibodies. Day 0 refers to the analysis of non-deleted Pax5F/FCreED-30 pro-B cells (without OHT treatment). These experiments demonstrate that the Pax5Uppercase Greek Letter Delta/Uppercase Greek Letter Delta pro-B cells regained the T-lymphoid potential already within 4 days and thus irrespective of the duration of in vitro culturing following Pax5 inactivation.

Download Supplemental Figure 2 [PDF File]

Supplemental Table 1. Oligonucleotides used for RT-PCR analysis.
genesequencesannealing °Ccyclessize (bp)
IgGreek Letter Deltam5�ACCCAAAAGGAAAGAAAAACC3�5525595
5�GTAGAGCAGTGTGAGCAGGAA3�
IgGreek Letter Mum5�GTGTTTGTGTGGAAGACTGGA3�5525513
5�AGGAGGAAGAGGACGATGAAG3�
J-chain5�GACAAGATGAAGACCCACCTG3�5530338
5�TTGCTCTGGGTGGCAGTAACA3�
Pax55�AGAGAAAAATTACCCGACTCCTC3� 5525593(FL)
5�CATCCCTCTTGCGTTTGTTGGTG3�427(Uppercase Greek Letter DeltaE2)
HPRT5�GGGGGCTATAAGTTCTTTGC3�5525313
5�TCCAACACTTCGAGAGGTCC3�
EBF5�GCCCGTGGAGATTGAGAGGAC3�5530M481
5�GTGCTTGGAGTTATTGTGGAC3�
M-CSF-R5�TCCCCCAGAGGTCAGTGTTAC3�57301200
5�GCCAGTCCAAAGTCCCCAATC3�
CD195�gcggaattCCCAGTCATGAAGAAGATGCA3�5925847
5�gcgggatccGCAGCACTTGAGTAGGTTCAC3�
mb-15�gcggaatTCCACCATCCCTGACGGTGAA3�5930820
5�gcgggatccGGGGGTGACACTAACGAGGAT3�
B295�gcggaattcCTGTGGCACGGAACTTCTAGT3� 5930243
5�gcgaagcttCCTGTCCGAAGAGTCACTATG3�
CIITA5�CCTGGGCATCTGAGGACTTTT3�5930764
5�GGGGATACTGAGGCTGCTTGA3�
rEST15�AGTGGCAAAGGAGGTAGAGAT3�57 25492
5�AACATAGGGAAGCAACAGAAT3�
rEST25�CAAAAGAAGTCCAGAGCAGTC3�57 25680
5�GGGCAAAATAGGGCATCAGTT3�
rEST35�GTGGGCAATCAGAGTCGTCAA3�5730595
5�ATGTGGGAGTGCTGTGGAGAT3�
Pax5-lacZ5�CATGGCGAGAAGCTCTTTAGTTCC3�5525611
5�TGCAAGGCGATTAAGTTGGGTAAC3�


Supplemental References

S1. P. Urbánek, Z.-Q. Wang, I. Fetka, E. F. Wagner, M. Busslinger, Cell79, 901 (1994).

S2. M. Horcher, A. Souabni, M. Busslinger, Immunity14, 779 (2001).

S3. Y. Shinkai, et al., Cell68, 855 (1992).

S4. F. Schwenk, R. K�hn, P.-O. Angrand, K. Rajewsky, A. F. Stewart, Nucleic Acids Res.26, 1427 (1998).

S5. S. L. Nutt, P. Urbánek, A. Rolink, M. Busslinger, Genes Dev.11, 476 (1997).

S6. S. L. Nutt, et al., Nature Genet.21, 390 (1999).

S7. B. Adams, et al., Genes Dev.6, 1589 (1992).

S8. S. L. Nutt, B. Heavey, A. G. Rolink, M. Busslinger, Nature401, 556 (1999).

S9. A. G. Rolink, S. L. Nutt, F. Melchers, M. Busslinger, Nature401, 603 (1999).

S10. M. L. Deftos, Y.-W. He, E. W. Ojala, M. J. Bevan, Immunity9, 777 (1998).