Table 1

Primers and probes.

Gene segmentOligonucleotide pairs for PCR from mononucleosomesProbes or oligonucleotide pairs used to generate probes by PCR
Control
Oct-2 Oct5: 5′-tggaggagctggaacagtttOct1: 5′-ttgcttagccccatccagg
Oct6: 5′-tgtttggaccttggcatctttgOct6
Human TCRδ minilocus
Vδ1Vδ1-67: 5′-acaagttggtggtcatattaVδ1 (20)
Vδ1LU: 5′-cgatggcattctgttcatca
Dδ3Dδ3UI: 5′-agaagagccccagaDδ3 (24)
Dδ3H4: 5′-tatatggcccctgagaatcc
Jδ1Jδ1H1: 5′-gtgacaccgataaactcJδ1 (20)
Jδ1H3: 5′-ggaggatgccttaacctt
EδH3: 5′-cccttgaaagtcagccagagEδH1: 5′-aaacaaggagatagggtgt
EδH4: 5′-gctgaagccacttgataacagEδH6: 5′-ctgctttcaacctgcttgag
CδH3: 5′-ctctgctcaactgagcactaCδ (20)
CδH4: 5′-tcctccacgccatgcagaat
Endogenous murine TCRα/δ locus
MCD9: 5′-acttctcagtgcttcagacMCD7: 5′-tatttacaggtgggctgac
MCD12: 5′-cagggcttttgcttttcttcMCD12
MED1: 5′-caaaatacatgcccagccaMED1
MED2: 5′-cagcaaaactgataaccccMED6: 5′-gggtttcttagaattatctgc
Vδ5MVD9: 5′-ttcacagaaaatcgaccttgaMVD7: 5′-ggcacagtaataagtagcg
MVD12: 5′-caatgcggattctccaaacMVD12
BEADMBD3: 5′-ttgcatacatgaggctctgMBD1: 5′-ctgcttcactgaagagttc
MBD6: 5′tgatgttccaaatatggcatgMBD6
TEATEA5: 5′-ctgtcccaagactttaagagTEA1: 5′-tctttaccttcccagtgag
TEA6: 5′-accaagacattctgttacccTEA6
Jα25MJA1: 5′-tgtgtgctagatcttgccMJA1
MJA2: 5′-gtgtcttggaatattgtgacMJA6: 5′ggtgtatcttaaaattagccc
MCA5: 5′-tgggctgcagaacacaatMCA1: 5′-taagtcctaagactggacc
MCA6: 5′-tgttctttggctgtgtgagMCA6
MEA1: 5′-agatagtgaatcaatagccagMEA1
MEA2: 5′-ttcaaagggggacctgtttMEA6: 5′-gagagatcttatctctaactc