D. melanogaster miRNAs. The sequences given represent the most abundant, and typically longest, miRNA sequence identified by cloning; miRNAs frequently vary in length by one or two nucleotides at their 3′ termini. From 222 short RNAs sequenced, 69 (31%) corresponded to miRNAs, 103 (46%) to already characterized functional RNAs (rRNA, 7SL RNA, and tRNA), 30 (14%) to transposon RNA fragments, and 20 (10%) sequences had no database entry. The frequency for cloning a particular miRNA as a percentage relative to all identified miRNAs is indicated. Results of Northern blotting of total RNA isolated from staged populations of D. melanogaster are summarized. E, embryo; L, larval stage; P, pupa; A, adult; S2, Schneider-2 cells. The strength of the signal within each blot is represented from strongest (+++) to undetected (−). let-7 stRNA was probed as the control. GenBank accession numbers and homologs of miRNAs identified by database searching in other species are provided in (21).
| miRNA | Sequence (5′ to 3′) | Freq. (%) | E 0 to 3 hours | E 0 to 6 hours | L1 + L2 | L3 | P | A | S2 |
|---|---|---|---|---|---|---|---|---|---|
| miR-1 | UGGAAUGUAAAGAAGUAUGGAG | 32 | + | + | +++ | +++ | ++ | +++ | – |
| miR-2a* | UAUCACAGCCAGCUUUGAUGAGC | 3 | |||||||
| miR-2b* | UAUCACAGCCAGCUUUGAGGAGC | 3 | ++ | ++ | ++ | +++ | ++ | + | +++ |
| miR-3 | UCACUGGGCAAAGUGUGUCUCA | 9 | +++ | +++ | – | – | – | – | – |
| miR-4 | AUAAAGCUAGACAACCAUUGA | 6 | +++ | +++ | – | – | – | – | – |
| miR-5 | AAAGGAACGAUCGUUGUGAUAUG | 1 | +++ | +++ | +/– | +/– | – | – | – |
| miR-6 | UAUCACAGUGGCUGUUCUUUUU | 13 | +++ | +++ | +/– | +/– | – | – | – |
| miR-7 | UGGAAGACUAGUGAUUUUGUUGU | 4 | +++ | ++ | +/– | +/– | +/– | +/– | +/– |
| miR-8 | UAAUACUGUCAGGUAAAGAUGUC | 3 | +/– | +/– | +++ | +++ | + | +++ | – |
| miR-9 | UCUUUGGUUAUCUAGCUGUAUGA | 7 | +++ | ++ | +++ | +++ | +++ | +/– | – |
| miR-10 | ACCCUGUAGAUCCGAAUUUGU | 1 | + | + | ++ | +++ | +/– | + | – |
| miR-11 | CAUCACAGUCUGAGUUCUUGC | 7 | +++ | +++ | +++ | +++ | +++ | + | – |
| miR-12 | UGAGUAUUACAUCAGGUACUGGU | 7 | + | + | ++ | ++ | + | +++ | +/– |
| miR-13a* | UAUCACAGCCAUUUUGACGAGU | 1 | +++ | +++ | +++ | +++ | + | +++ | +++ |
| miR-13b* | UAUCACAGCCAUUUUGAUGAGU | 0 | |||||||
| miR-14 | UCAGUCUUUUUCUCUCUCCUA | 1 | – | – | – | – | – | – | – |
| let-7 | UGAGGUAGUAGGUUGUAUAGUU | 0 | – | – | – | – | +++ | +++ | – |
↵* Similar miRNA sequences are difficult to distinguished by Northern blotting because of potential cross-hybridization of probes.