Table 1

D. melanogaster miRNAs. The sequences given represent the most abundant, and typically longest, miRNA sequence identified by cloning; miRNAs frequently vary in length by one or two nucleotides at their 3′ termini. From 222 short RNAs sequenced, 69 (31%) corresponded to miRNAs, 103 (46%) to already characterized functional RNAs (rRNA, 7SL RNA, and tRNA), 30 (14%) to transposon RNA fragments, and 20 (10%) sequences had no database entry. The frequency for cloning a particular miRNA as a percentage relative to all identified miRNAs is indicated. Results of Northern blotting of total RNA isolated from staged populations of D. melanogaster are summarized. E, embryo; L, larval stage; P, pupa; A, adult; S2, Schneider-2 cells. The strength of the signal within each blot is represented from strongest (+++) to undetected (−). let-7 stRNA was probed as the control. GenBank accession numbers and homologs of miRNAs identified by database searching in other species are provided in (21).

miRNASequence (5′ to 3′)Freq. (%)E 0 to 3 hours E 0 to 6 hours L1 + L2L3PAS2
miR-1UGGAAUGUAAAGAAGUAUGGAG32+++++++++++++
miR-2a* UAUCACAGCCAGCUUUGAUGAGC3
miR-2b* UAUCACAGCCAGCUUUGAGGAGC3+++++++++++++++
miR-3UCACUGGGCAAAGUGUGUCUCA9++++++
miR-4AUAAAGCUAGACAACCAUUGA6++++++
miR-5AAAGGAACGAUCGUUGUGAUAUG1+++++++/–+/–
miR-6UAUCACAGUGGCUGUUCUUUUU13+++++++/–+/–
miR-7UGGAAGACUAGUGAUUUUGUUGU4++++++/–+/–+/–+/–+/–
miR-8UAAUACUGUCAGGUAAAGAUGUC3+/–+/–++++++++++
miR-9UCUUUGGUUAUCUAGCUGUAUGA7+++++++++++++++/–
miR-10ACCCUGUAGAUCCGAAUUUGU1++++++++/–+
miR-11CAUCACAGUCUGAGUUCUUGC7++++++++++++++++
miR-12UGAGUAUUACAUCAGGUACUGGU7+++++++++++/–
miR-13a* UAUCACAGCCAUUUUGACGAGU1+++++++++++++++++++
miR-13b* UAUCACAGCCAUUUUGAUGAGU0
miR-14UCAGUCUUUUUCUCUCUCCUA1
let-7UGAGGUAGUAGGUUGUAUAGUU0++++++
  • * Similar miRNA sequences are difficult to distinguished by Northern blotting because of potential cross-hybridization of probes.