Table 2

Mutations in MEN1, DAXX, ATRX, PTEN, TSC2, PIK3CA, and TP53 in human PanNETs. (hom) indicates these mutations appear homozygous.

Sample*GeneTranscript accessionNucleotide (genomic)†Nucleotide (cDNA)Amino acid (protein) ‡Mutation type
PanNET3PTATRXCCDS14434.1g.chrX:76716462G>A (hom)c.6235C>T(hom)p.R2079XNonsense
PanNET5PTATRXCCDS14434.1g.chrX:76742636G>Ac.5620C>Tp.Q1874XNonsense
PanNET13PTATRXCCDS14434.1g.chrX:76741560delAc.5932delTfsIndel
PanNET27PTATRXCCDS14434.1g.chrX:76700959_76700962delATAAc.6338_6341delTTATfsIndel
PanNET35PTATRXCCDS14434.1g.chrX:76806893_76806909delAATTTCTTCTAAAAGCAc.3824_3840delTGCTTTTAGAAGAAATTfsIndel
PanNET52PTATRXCCDS14434.1g.chrX:76796337_76796340delCTTTc.4221_4224delAAAGfsIndel
PanNET59PTATRXCCDS14434.1g.chrX:76761014C>Ac.5364G>Tp.Q1788HMissense
PanNET78PTATRXCCDS14434.1g.chrX:76665406C>Tc.6829G>Ap.E2277KMissense
PanNET85PTATRXCCDS14434.1g.chrX:76794404dupCc.4414dupGfsIndel
PanNET98PTATRXCCDS14434.1g.chrX:76700832T>A(hom)c.6468A>T(hom)p.Q2156HMissense
PanNET100PTATRXCCDS14434.1g.chrX:76762518_76762521delCACT(hom)c.5270_5272delAGTG(hom)fsIndel
PanNET112PTATRXCCDS14434.1g.chrX:76826041T>A(hom)c.1363A>T(hom)p.K455XNonsense
PanNET25PTDAXXCCDS4776.1g.chr6:33394939delTc.1976delAfsIndel
PanNET31PTDAXXCCDS4776.1g.chr6:33394935delC(hom)c.1980delG(hom)fsIndel
PanNET44PTDAXXCCDS4776.1g.chr6:33394795delGc.2120delCfsIndel
PanNET56PTDAXXCCDS4776.1g.chr6:33397319delGc.211delCfsIndel
PanNET77PTDAXXCCDS4776.1g.chr6:33396614G>Ac.916C>Tp.R306XNonsense
PanNET84PTDAXXCCDS4776.1g.chr6:33395309delGc.1766delCfsIndel
PanNET87PTDAXXCCDS4776.1g.chr6:33397141A>Cc.389T>Gp.L130RMissense
PanNET93PTDAXXCCDS4776.1g.chr6:33396641C>Gc.889G>Cp.A297PMissense
PanNET94PTDAXXCCDS4776.1g.chr6:33394872_33394873insAc.2042_2043insTfsIndel
PanNET95PTDAXXCCDS4776.1g.chr6:33397221_33397224delCGCCc.306_309delGGCGfsIndel
PanNET96PTDAXXCCDS4776.1g.chr6:33396167delCc.1219delGfsIndel
PanNET97PTDAXXCCDS4776.1g.chr6:33395838C>A(hom)c.1393G>T(hom)p.E465XNonsense
PanNET102PTDAXXCCDS4776.1g.chr6:33397515T>Ac.166A>Tp.K56XNonsense
PanNET103PTDAXXCCDS4776.1g.chr6:33397579delAc.102delTfsIndel
PanNET104PTDAXXCCDS4776.1g.chr6:33396604_33396605insACT(hom)c.925_926insAGT(hom)p.L309QFIndel/missense
PanNET108PTDAXXCCDS4776.1g.chr6:33395828delT(hom)c.1403delA(hom)fsIndel
PanNET133PTDAXXCCDS4776.1g.chr6:33395889C>A(hom)c.1342G>T(hom)p.E448XNonsense
PanNET3PTMEN1CCDS8083.1g.chr11:64331709C>A(hom)c.689G>T(hom)p.G230VMissense
PanNET5PTMEN1CCDS8083.1g.chr11:64332046A>G(hom)c.562T>C(hom)p.W188RMissense
PanNET6PTMEN1CCDS8083.1g.chr11:64333812_64333828delCACGGCTGGAGACACCCc.329_345delGGGTGTCTCCAGCCGTGfsIndel
PanNET10PTMEN1CCDS8083.1g.chr11:64334105_64334108delTCGT(hom)c.50_53delACGA(hom)fsIndel
PanNET23PTMEN1CCDS8083.1g.chr11:64331233_64331234delAG(hom)c.832_833delCT(hom)fsIndel
PanNET29PTMEN1CCDS8083.1g.chr11:64334070C>A(hom)c.88G>T(hom)p.E30XNonsense
PanNET31PTMEN1CCDS8083.1g.chr11:64328587G>Tc.1643C>Ap.S548XNonsense
PanNET39PTMEN1CCDS8083.1g.chr11:64333993_64333999delAGGGATG(hom)c.159_165delCATCCCT(hom)fsIndel
PanNET44PTMEN1CCDS8083.1g.chr11:64333955delGc.203delCfsIndel
PanNET45PTMEN1CCDS8083.1g.chr11:64330370G>Cc.974C>Gp.P325RMissense
PanNET52PTMEN1CCDS8083.1g.chr11:64333876delGc.282delCfsIndel
PanNET57PTMEN1CCDS8083.1g.chr11:64334002delG(hom)c.156delC(hom)fsIndel
PanNET59PTMEN1CCDS8083.1g.chr11:64329234G>Ac.1213C>Tp.Q405XNonsense
PanNET61PTMEN1CCDS8083.1g.chr11:64334049_64334201delGGAGCACCAGGTCCGGCTCCTCTCGGCCCAGCTCGGCAGCAAACAGGCGCACCACGTCGTCGATGGAGCGCAGCGGGAACAGCGTCTTCTGGGCGGCCTTCAGCCCCATGGCGGCGGGCGGTGGGCGGCGGCCTGCAAGGCAAGCCGGGGGAG(hom)c.1_109delATGGGGCTGAAGGCCGCCCAGAAGACGCTGTTCCCGCTGCGCTCCATCGACGACGTGGTGCGCCTGTTTGCTGCCGAGCTGGGCCGAGAGGAGCCGGACCTGGTGCTCC(hom)fsIndel
PanNET64PTMEN1CCDS8083.1g.chr11:64333781delCc.377delGfsIndel
PanNET69PTMEN1CCDS8083.1g.chr11:64330291delAc.1053delTfsIndel
PanNET77PTMEN1CCDS8083.1g.chr11:64334063_64334079delGGCTCCTCTCGGCCCAGc.79_95delCTGGGCCGAGAGGAGCCfsIndel
PanNET78PTMEN1CCDS8083.1g.chr11:64332045C>Tc.563G>Ap.W188XNonsense
PanNET83PTMEN1CCDS8083.1g.chr11:64330369delGc.975delCfsIndel
PanNET84PTMEN1CCDS8083.1g.chr11:64334139G>Ac.19C>Tp.Q7XNonsense
PanNET85PTMEN1CCDS8083.1g.chr11:64332011_64332012insCTGTc.596_597insACAGfsIndel
PanNET93PTMEN1CCDS8083.1g.chr11:64333906_64333909delAGACc.249_252delGTCTfsIndel
PanNET94PTMEN1CCDS8083.1g.chr11:64333906_64333909delAGACc.249_252delGTCTfsIndel
PanNET95PTMEN1CCDS8083.1g.chr11:64332032delC(hom)c.576delG(hom)fsIndel
PanNET96PTMEN1CCDS8083.1g.chr11:64331269T>Cc.IVS799-2A>Gc.IVS799-2A>GSplice site
PanNET99PTMEN1CCDS8083.1g.chr11:64331938C>Ac.IVS669+1G>Tc.IVS669+1G>TSplice site
PanNET100PTMEN1CCDS8083.1g.chr11:64331940_64331941delCG(hom)c.667_668delCG(hom)fsIndel
PanNET102PTMEN1CCDS8083.1g.chr11:64332102G>Ac.506C>Tp.A169VMissense
PanNET108PTMEN1CCDS8083.1g.chr11:64331200_64331251delGCAGCCTGGCCACTTCCCTCTACTGACCTTTCCAGATGTCCCAGGTCATAGA(hom)c.815_837delTCTATGACCTGGGACATCTGGAA(hom)del exon and intronIndel
PanNET109PTMEN1CCDS8083.1g.chr11:64334093A>Cc.65T>Gp.L22RMissense
PanNET10PTPIK3CACCDS43171.1g.chr3:180418785G>Ac.1633G>Ap.E545KMissense
PanNET10PTPTENCCDS31238.1g.chr10:89707693delGc.738delGfsIndel
PanNET31PTPTENCCDS31238.1g.chr10:89682819T>Gc.323T>Gp.L108RMissense
PanNET29PTPTENCCDS31238.1g.chr10:89710790_89710791insTGACAAGGAATATCTAGTACTTACTTTAAc.961_962insTGACAAGGAATATCTAGTACTTACTTTAAfsIndel
PanNET96PTPTENCCDS31238.1g.chr10:89675287T>C(hom)c.202T>C(hom)p.Y68HMissense
PanNET104PTPTENCCDS31238.1g.chr10:89701856G>A(hom)c.494G>A(hom)p.G165EMissense
PanNET24PTTP53CCDS11118.1g.chr17:7518284G>Ac.722C>Tp.S241FMissense
PanNET91PTTP53CCDS11118.1g.chr17:7519210delA(hom)c.445delT(hom)fsIndel
PanNET100PTTP53CCDS11118.1g.chr17:7520101delT(hom)c.311delA(hom)fsIndel
PanNET2PTTSC2CCDS10458.1g.chr16:2070191C>Tc.3422C>Tp.A1141VMissense
PanNET31PTTSC2CCDS10458.1g.chr16:2074957G>Ac.4498G>Ap.V1500MMissense
PanNET44PTTSC2CCDS10458.1g.chr16:2074337_2074338delTGc.4113_c.4114delTGfsIndel
PanNET70PTTSC2CCDS10458.1g.chr16:2078571C>Tc.5383C>Tp.R1795CMissense
PanNET93PTTSC2CCDS10458.1g.chr16:2038643C>Ac.26C>Ap.S9XNonsense
PanNET112PTTSC2CCDS10458.1g.chr16:2076836A>Gc.4952A>Gp.N1651SMissense

*Samples PanNET3, PanNET7, PanNET10, PanNET21, PanNET23, PanNET24, PanNET25, PanNET31, PanNET36, and PanNET93 were used for the initial (discovery set) screen.

†Coordinates refer to human reference genome hg18 release (NCBI 36.1, March 2006).

‡Single-letter abbreviations for the amino acid residues are as follows: A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, Ile; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; S,Ser; T, Thr; V, Val; W, Trp; and Y, Tyr.